ID: 1185149098

View in Genome Browser
Species Human (GRCh38)
Location 22:49154128-49154150
Sequence GGCCAAGAAGGACCCCCGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185149098_1185149102 -2 Left 1185149098 22:49154128-49154150 CCTTGCGGGGGTCCTTCTTGGCC No data
Right 1185149102 22:49154149-49154171 CCAGCCTCCTCCCCGCTGCAGGG No data
1185149098_1185149113 29 Left 1185149098 22:49154128-49154150 CCTTGCGGGGGTCCTTCTTGGCC No data
Right 1185149113 22:49154180-49154202 AGGGCCCCGGAGACCCAGTAAGG No data
1185149098_1185149108 9 Left 1185149098 22:49154128-49154150 CCTTGCGGGGGTCCTTCTTGGCC No data
Right 1185149108 22:49154160-49154182 CCCGCTGCAGGGGAGACCTCAGG No data
1185149098_1185149110 10 Left 1185149098 22:49154128-49154150 CCTTGCGGGGGTCCTTCTTGGCC No data
Right 1185149110 22:49154161-49154183 CCGCTGCAGGGGAGACCTCAGGG No data
1185149098_1185149103 -1 Left 1185149098 22:49154128-49154150 CCTTGCGGGGGTCCTTCTTGGCC No data
Right 1185149103 22:49154150-49154172 CAGCCTCCTCCCCGCTGCAGGGG No data
1185149098_1185149111 16 Left 1185149098 22:49154128-49154150 CCTTGCGGGGGTCCTTCTTGGCC No data
Right 1185149111 22:49154167-49154189 CAGGGGAGACCTCAGGGCCCCGG No data
1185149098_1185149100 -3 Left 1185149098 22:49154128-49154150 CCTTGCGGGGGTCCTTCTTGGCC No data
Right 1185149100 22:49154148-49154170 GCCAGCCTCCTCCCCGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185149098 Original CRISPR GGCCAAGAAGGACCCCCGCA AGG (reversed) Intergenic
No off target data available for this crispr