ID: 1185150892

View in Genome Browser
Species Human (GRCh38)
Location 22:49163485-49163507
Sequence ATGCCCGCCTTGAATGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185150892_1185150895 3 Left 1185150892 22:49163485-49163507 CCGCCATCATTCAAGGCGGGCAT No data
Right 1185150895 22:49163511-49163533 TTAGGAGACGAAATGCCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185150892 Original CRISPR ATGCCCGCCTTGAATGATGG CGG (reversed) Intergenic
No off target data available for this crispr