ID: 1185155711

View in Genome Browser
Species Human (GRCh38)
Location 22:49192267-49192289
Sequence GCGGCCAACCCAGGTGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185155706_1185155711 -6 Left 1185155706 22:49192250-49192272 CCTTGCCTGTGGTTGCAGCGGCC No data
Right 1185155711 22:49192267-49192289 GCGGCCAACCCAGGTGCAAGGGG No data
1185155702_1185155711 8 Left 1185155702 22:49192236-49192258 CCTGCCTGCAGCTGCCTTGCCTG No data
Right 1185155711 22:49192267-49192289 GCGGCCAACCCAGGTGCAAGGGG No data
1185155701_1185155711 9 Left 1185155701 22:49192235-49192257 CCCTGCCTGCAGCTGCCTTGCCT No data
Right 1185155711 22:49192267-49192289 GCGGCCAACCCAGGTGCAAGGGG No data
1185155704_1185155711 4 Left 1185155704 22:49192240-49192262 CCTGCAGCTGCCTTGCCTGTGGT No data
Right 1185155711 22:49192267-49192289 GCGGCCAACCCAGGTGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185155711 Original CRISPR GCGGCCAACCCAGGTGCAAG GGG Intergenic
No off target data available for this crispr