ID: 1185155782

View in Genome Browser
Species Human (GRCh38)
Location 22:49192625-49192647
Sequence TGGGGCTCAAAGTGTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185155775_1185155782 28 Left 1185155775 22:49192574-49192596 CCCTGTTGTTCAGGGAAACAGGT No data
Right 1185155782 22:49192625-49192647 TGGGGCTCAAAGTGTGAGCCAGG No data
1185155776_1185155782 27 Left 1185155776 22:49192575-49192597 CCTGTTGTTCAGGGAAACAGGTG No data
Right 1185155782 22:49192625-49192647 TGGGGCTCAAAGTGTGAGCCAGG No data
1185155778_1185155782 -3 Left 1185155778 22:49192605-49192627 CCACAGATGTTCTGCTTCTCTGG No data
Right 1185155782 22:49192625-49192647 TGGGGCTCAAAGTGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185155782 Original CRISPR TGGGGCTCAAAGTGTGAGCC AGG Intergenic
No off target data available for this crispr