ID: 1185156050

View in Genome Browser
Species Human (GRCh38)
Location 22:49194150-49194172
Sequence TGGGATCCCCCGGAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185156050_1185156056 -10 Left 1185156050 22:49194150-49194172 CCCACCTCCTCCGGGGGATCCCA No data
Right 1185156056 22:49194163-49194185 GGGGATCCCAGCGGCCATCCTGG No data
1185156050_1185156060 -2 Left 1185156050 22:49194150-49194172 CCCACCTCCTCCGGGGGATCCCA No data
Right 1185156060 22:49194171-49194193 CAGCGGCCATCCTGGGTGTCTGG No data
1185156050_1185156057 -9 Left 1185156050 22:49194150-49194172 CCCACCTCCTCCGGGGGATCCCA No data
Right 1185156057 22:49194164-49194186 GGGATCCCAGCGGCCATCCTGGG No data
1185156050_1185156063 20 Left 1185156050 22:49194150-49194172 CCCACCTCCTCCGGGGGATCCCA No data
Right 1185156063 22:49194193-49194215 GATGCTCGTCCTTGTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185156050 Original CRISPR TGGGATCCCCCGGAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr