ID: 1185157564

View in Genome Browser
Species Human (GRCh38)
Location 22:49203356-49203378
Sequence CTCAAGATGCAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185157560_1185157564 -7 Left 1185157560 22:49203340-49203362 CCATGCAACGAGGCTCCTCAAGA No data
Right 1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG No data
1185157558_1185157564 3 Left 1185157558 22:49203330-49203352 CCACGCGTTTCCATGCAACGAGG No data
Right 1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG No data
1185157557_1185157564 8 Left 1185157557 22:49203325-49203347 CCGCGCCACGCGTTTCCATGCAA No data
Right 1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185157564 Original CRISPR CTCAAGATGCAGAGGAAGGA AGG Intergenic
No off target data available for this crispr