ID: 1185159492

View in Genome Browser
Species Human (GRCh38)
Location 22:49214657-49214679
Sequence GGGTTGCTGTTGCATGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185159491_1185159492 -7 Left 1185159491 22:49214641-49214663 CCTTGTGTTTGTGAAAGGGTTGC No data
Right 1185159492 22:49214657-49214679 GGGTTGCTGTTGCATGCAGTAGG No data
1185159490_1185159492 -6 Left 1185159490 22:49214640-49214662 CCCTTGTGTTTGTGAAAGGGTTG No data
Right 1185159492 22:49214657-49214679 GGGTTGCTGTTGCATGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185159492 Original CRISPR GGGTTGCTGTTGCATGCAGT AGG Intergenic
No off target data available for this crispr