ID: 1185160405

View in Genome Browser
Species Human (GRCh38)
Location 22:49224322-49224344
Sequence CCCAAGTCTCCATGGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185160395_1185160405 25 Left 1185160395 22:49224274-49224296 CCCAAGTTCATGGGAGCCTGTTC No data
Right 1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG No data
1185160401_1185160405 -6 Left 1185160401 22:49224305-49224327 CCAAGAGGTGGAAGCAACCCAAG 0: 29
1: 164
2: 672
3: 2061
4: 4331
Right 1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG No data
1185160397_1185160405 9 Left 1185160397 22:49224290-49224312 CCTGTTCCACAATAGCCAAGAGG No data
Right 1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG No data
1185160400_1185160405 3 Left 1185160400 22:49224296-49224318 CCACAATAGCCAAGAGGTGGAAG No data
Right 1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG No data
1185160396_1185160405 24 Left 1185160396 22:49224275-49224297 CCAAGTTCATGGGAGCCTGTTCC No data
Right 1185160405 22:49224322-49224344 CCCAAGTCTCCATGGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185160405 Original CRISPR CCCAAGTCTCCATGGATGGA TGG Intergenic
No off target data available for this crispr