ID: 1185160528

View in Genome Browser
Species Human (GRCh38)
Location 22:49225575-49225597
Sequence TAGTATATTAATAAAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185160528_1185160531 -7 Left 1185160528 22:49225575-49225597 CCTTCTTCTTTATTAATATACTA No data
Right 1185160531 22:49225591-49225613 TATACTAGAGGTCCCGCCCAGGG No data
1185160528_1185160530 -8 Left 1185160528 22:49225575-49225597 CCTTCTTCTTTATTAATATACTA No data
Right 1185160530 22:49225590-49225612 ATATACTAGAGGTCCCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185160528 Original CRISPR TAGTATATTAATAAAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr