ID: 1185163967

View in Genome Browser
Species Human (GRCh38)
Location 22:49246522-49246544
Sequence GTGGCTGCCCAGAAATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185163967_1185163975 7 Left 1185163967 22:49246522-49246544 CCTTCCCATTTCTGGGCAGCCAC No data
Right 1185163975 22:49246552-49246574 TGGGGTTTGTTATAATTTTATGG No data
1185163967_1185163976 8 Left 1185163967 22:49246522-49246544 CCTTCCCATTTCTGGGCAGCCAC No data
Right 1185163976 22:49246553-49246575 GGGGTTTGTTATAATTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185163967 Original CRISPR GTGGCTGCCCAGAAATGGGA AGG (reversed) Intergenic
No off target data available for this crispr