ID: 1185164004

View in Genome Browser
Species Human (GRCh38)
Location 22:49247185-49247207
Sequence CTTTTCAGAGGCAGTTAATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185164004_1185164011 4 Left 1185164004 22:49247185-49247207 CCGAATTAACTGCCTCTGAAAAG No data
Right 1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG No data
1185164004_1185164010 -4 Left 1185164004 22:49247185-49247207 CCGAATTAACTGCCTCTGAAAAG No data
Right 1185164010 22:49247204-49247226 AAAGGAGTTTGCTGGGGAATAGG No data
1185164004_1185164012 11 Left 1185164004 22:49247185-49247207 CCGAATTAACTGCCTCTGAAAAG No data
Right 1185164012 22:49247219-49247241 GGAATAGGAAAGATGGTTCCTGG No data
1185164004_1185164009 -10 Left 1185164004 22:49247185-49247207 CCGAATTAACTGCCTCTGAAAAG No data
Right 1185164009 22:49247198-49247220 CTCTGAAAAGGAGTTTGCTGGGG No data
1185164004_1185164013 14 Left 1185164004 22:49247185-49247207 CCGAATTAACTGCCTCTGAAAAG No data
Right 1185164013 22:49247222-49247244 ATAGGAAAGATGGTTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185164004 Original CRISPR CTTTTCAGAGGCAGTTAATT CGG (reversed) Intergenic
No off target data available for this crispr