ID: 1185164007

View in Genome Browser
Species Human (GRCh38)
Location 22:49247197-49247219
Sequence CCCAGCAAACTCCTTTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185164007_1185164012 -1 Left 1185164007 22:49247197-49247219 CCTCTGAAAAGGAGTTTGCTGGG No data
Right 1185164012 22:49247219-49247241 GGAATAGGAAAGATGGTTCCTGG No data
1185164007_1185164013 2 Left 1185164007 22:49247197-49247219 CCTCTGAAAAGGAGTTTGCTGGG No data
Right 1185164013 22:49247222-49247244 ATAGGAAAGATGGTTCCTGGAGG No data
1185164007_1185164015 19 Left 1185164007 22:49247197-49247219 CCTCTGAAAAGGAGTTTGCTGGG No data
Right 1185164015 22:49247239-49247261 TGGAGGCGTTTCCTTCACTCTGG No data
1185164007_1185164011 -8 Left 1185164007 22:49247197-49247219 CCTCTGAAAAGGAGTTTGCTGGG No data
Right 1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185164007 Original CRISPR CCCAGCAAACTCCTTTTCAG AGG (reversed) Intergenic
No off target data available for this crispr