ID: 1185164011

View in Genome Browser
Species Human (GRCh38)
Location 22:49247212-49247234
Sequence TTGCTGGGGAATAGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185164007_1185164011 -8 Left 1185164007 22:49247197-49247219 CCTCTGAAAAGGAGTTTGCTGGG No data
Right 1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG No data
1185164003_1185164011 5 Left 1185164003 22:49247184-49247206 CCCGAATTAACTGCCTCTGAAAA No data
Right 1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG No data
1185164004_1185164011 4 Left 1185164004 22:49247185-49247207 CCGAATTAACTGCCTCTGAAAAG No data
Right 1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185164011 Original CRISPR TTGCTGGGGAATAGGAAAGA TGG Intergenic
No off target data available for this crispr