ID: 1185164402

View in Genome Browser
Species Human (GRCh38)
Location 22:49251912-49251934
Sequence GAGTGTGAGCTGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185164394_1185164402 11 Left 1185164394 22:49251878-49251900 CCCATCTTTCTCTCTGTAGACCT No data
Right 1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG No data
1185164395_1185164402 10 Left 1185164395 22:49251879-49251901 CCATCTTTCTCTCTGTAGACCTC No data
Right 1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG No data
1185164393_1185164402 20 Left 1185164393 22:49251869-49251891 CCAATCACACCCATCTTTCTCTC No data
Right 1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG No data
1185164397_1185164402 -9 Left 1185164397 22:49251898-49251920 CCTCTAGCCTAAAGGAGTGTGAG No data
Right 1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185164402 Original CRISPR GAGTGTGAGCTGAGGGAAGG AGG Intergenic
No off target data available for this crispr