ID: 1185165952

View in Genome Browser
Species Human (GRCh38)
Location 22:49262350-49262372
Sequence CCCCTGCGGTACCCAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185165952_1185165959 -10 Left 1185165952 22:49262350-49262372 CCTCCCCCTGGGTACCGCAGGGG No data
Right 1185165959 22:49262363-49262385 ACCGCAGGGGCCCTGGCCTCTGG No data
1185165952_1185165966 12 Left 1185165952 22:49262350-49262372 CCTCCCCCTGGGTACCGCAGGGG No data
Right 1185165966 22:49262385-49262407 GATGAGAGCTGCTCCTGCAGGGG No data
1185165952_1185165965 11 Left 1185165952 22:49262350-49262372 CCTCCCCCTGGGTACCGCAGGGG No data
Right 1185165965 22:49262384-49262406 GGATGAGAGCTGCTCCTGCAGGG No data
1185165952_1185165964 10 Left 1185165952 22:49262350-49262372 CCTCCCCCTGGGTACCGCAGGGG No data
Right 1185165964 22:49262383-49262405 TGGATGAGAGCTGCTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185165952 Original CRISPR CCCCTGCGGTACCCAGGGGG AGG (reversed) Intergenic
No off target data available for this crispr