ID: 1185166418

View in Genome Browser
Species Human (GRCh38)
Location 22:49265263-49265285
Sequence CTAACTTTACCAAGGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185166418_1185166426 17 Left 1185166418 22:49265263-49265285 CCCTATTCCCTTGGTAAAGTTAG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1185166426 22:49265303-49265325 GTGCAAGAATTAGGATTGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 104
1185166418_1185166425 8 Left 1185166418 22:49265263-49265285 CCCTATTCCCTTGGTAAAGTTAG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1185166425 22:49265294-49265316 GAAAGACAGGTGCAAGAATTAGG 0: 1
1: 1
2: 2
3: 25
4: 254
1185166418_1185166424 -5 Left 1185166418 22:49265263-49265285 CCCTATTCCCTTGGTAAAGTTAG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1185166424 22:49265281-49265303 GTTAGGGCGTTTAGAAAGACAGG 0: 1
1: 0
2: 0
3: 5
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185166418 Original CRISPR CTAACTTTACCAAGGGAATA GGG (reversed) Intergenic
903271423 1:22190675-22190697 GTAACTTTCCCAAGGAAATGGGG - Intergenic
906221402 1:44082759-44082781 CTTGCCTTACCAAGGTAATAAGG - Intergenic
907144785 1:52222113-52222135 CTAAATTTCCTAAGGGAACAAGG - Intronic
907228100 1:52968279-52968301 CTAATTTCATCAAGGGAAAAGGG - Intronic
908755038 1:67461740-67461762 TCAACTTTACCAAGGTCATATGG - Intergenic
909334690 1:74458402-74458424 GTACCTTTACCAAGGAAATCTGG - Intronic
910698380 1:90046245-90046267 CCAACTTTAAGAAGGGGATATGG - Intergenic
911318894 1:96388086-96388108 CTCACTTTGCCATGAGAATAAGG - Intergenic
913188404 1:116391602-116391624 CTAAGTTGCCAAAGGGAATATGG + Intronic
913668631 1:121073700-121073722 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914020375 1:143861143-143861165 CTGAGTTGACTAAGGGAATAAGG + Intergenic
914658875 1:149769055-149769077 CTGAGTTGACTAAGGGAATAAGG + Intergenic
915971259 1:160356789-160356811 CCAACTTTCCCAAGGGAAAGGGG - Intronic
916240904 1:162638434-162638456 CCAACCTTACCATGGGGATATGG - Intronic
916608009 1:166362127-166362149 ATAACTTGACCAACGAAATAGGG + Intergenic
916636893 1:166680708-166680730 CGAACTTTACAAAATGAATAAGG + Intergenic
919720000 1:200823670-200823692 CTACCTTAACCAAGGGATCATGG - Intronic
920089988 1:203445655-203445677 CTTGCTTAACCAATGGAATATGG + Intergenic
921839216 1:219810652-219810674 CTATCTTTCCCAAGAGAACAAGG + Intronic
923255170 1:232215697-232215719 CTACATTTACCAAAGGAAGAAGG + Intergenic
923292357 1:232558463-232558485 CTACCTTCAGGAAGGGAATATGG + Intronic
923645365 1:235815071-235815093 CTAAGTTTACTAAGGGAAGCAGG - Intronic
1064780550 10:18833277-18833299 GTAACTTTCCCAAGGTAATATGG - Intergenic
1065068517 10:21998955-21998977 CTAACTTGTCCAAGGTCATAAGG + Intronic
1065921383 10:30396054-30396076 GTAACTTTCCCAAGGGGGTAGGG + Intergenic
1067460283 10:46453087-46453109 GAACCTTTGCCAAGGGAATATGG + Intergenic
1067626907 10:47931516-47931538 GAACCTTTGCCAAGGGAATATGG - Intergenic
1077630864 11:3810152-3810174 CTATCTTTACAATGGGAATAGGG + Intronic
1077868125 11:6239822-6239844 CTATCTTTAGGAAGGGAATGTGG - Intronic
1078456721 11:11481518-11481540 CTGACTTTCCCAAGGGACAAGGG + Intronic
1078648221 11:13162496-13162518 CTTACTTTACAAAGGAAAGAGGG - Intergenic
1079725335 11:23873688-23873710 TTAACTTTACAAAGGAAAAAGGG - Intergenic
1080264124 11:30383669-30383691 CTAACTATACCAATTGAATGTGG + Intergenic
1080404420 11:31966413-31966435 CTAAGTTTACAGAGTGAATAAGG + Intronic
1083344682 11:61981019-61981041 CTAACTTTACCCCTGGAAGAAGG - Intergenic
1084279995 11:68082287-68082309 CTATCTTTAATAAGGGAATGGGG + Intronic
1085840992 11:80011770-80011792 CCACCTTTACCAAGGGGATAGGG - Intergenic
1087313081 11:96573031-96573053 CTGACTCTACCAAGAGAATGAGG - Intergenic
1087536846 11:99458719-99458741 CTCACTATACCAAGGCTATATGG - Intronic
1087551868 11:99660853-99660875 AAAACTTTACCAAGGAACTAAGG - Intronic
1088061893 11:105663547-105663569 CTAGCTTTAATAAGGGAATAGGG + Intronic
1091206357 11:133823878-133823900 CAAACATTACCCAGGGAATCTGG + Intergenic
1094107588 12:26830970-26830992 GTAACTTTCCCAAGGTCATAAGG + Intronic
1094185690 12:27640254-27640276 CTCACTTTCCCAAAGGAACAGGG - Intronic
1094378455 12:29816957-29816979 CTGTCTTTACCAAAGTAATAGGG - Intergenic
1097759685 12:63448764-63448786 CTAACTTTCCCAAGGTCACATGG - Intergenic
1101073794 12:101106767-101106789 CTAACTCTTCCATGGGTATATGG + Intronic
1102743220 12:115226425-115226447 CTCACTTGACCAACAGAATATGG + Intergenic
1104121882 12:125807627-125807649 TTAACTTAACCAAGGGGATAAGG + Intergenic
1104658836 12:130594137-130594159 CTCACTTCACCAAGTGAAGATGG + Intronic
1106488613 13:30194962-30194984 CTAACTCTTCCAGGGGGATAGGG + Intergenic
1108158677 13:47615417-47615439 CTAACTTCAGCAAGGTATTAGGG + Intergenic
1117631128 14:57693203-57693225 CTAAATTTACCAAATGAGTAGGG + Intronic
1123142844 14:106097744-106097766 ATTACTTTACCATGGGATTAAGG - Intergenic
1127288823 15:57552904-57552926 CTAACCTAACCAAGGGCATGTGG + Intergenic
1127853843 15:62938734-62938756 CTAACGTTCCCTAGGGAAGAAGG + Intergenic
1129782330 15:78280882-78280904 ATAACTCTGCCAAGGGAAGAGGG - Exonic
1140269240 16:73448216-73448238 ATAACTTTAAAAAGGGAATGAGG + Intergenic
1142015888 16:87747070-87747092 GTATCTGTTCCAAGGGAATAGGG - Intronic
1143142255 17:4747488-4747510 CCACCTTAACCAAGGGATTAAGG + Intergenic
1143609953 17:8012436-8012458 CTACCCATTCCAAGGGAATAAGG + Exonic
1144304474 17:13955555-13955577 CTAAGTTTTCCAAGAGAACAAGG - Intergenic
1144823522 17:18091943-18091965 CTAACTTTTCCAAAGTAAAATGG + Intronic
1145768855 17:27478327-27478349 ATAACTTGACCAAGGTAAGAAGG - Intronic
1145847301 17:28051746-28051768 ATAACTTTACCAAGGTCACAGGG - Intronic
1155920318 18:31596979-31597001 GTAGATTTACCAAGGGAAAATGG + Intronic
1156249544 18:35339463-35339485 CTTACTGTACCAATGGAATTAGG + Intronic
1163097098 19:15067045-15067067 CTACCTTTACCAAGGAAAGAAGG + Intergenic
1164574909 19:29400431-29400453 CTCACTATGCCAAGGGAAAAGGG - Intergenic
926779846 2:16460344-16460366 TAAACTTTACCAAGGGTATGTGG - Intergenic
926972734 2:18483216-18483238 ATAACTTCATCATGGGAATATGG - Intergenic
930618593 2:53620894-53620916 CTAACATAACCAACAGAATAAGG + Intronic
932320280 2:70817191-70817213 CTAACATTTCCAAGGGAAATGGG + Intronic
932502536 2:72196347-72196369 CTAAATTTACCCAGGGTATAAGG - Intronic
932829729 2:74977552-74977574 CAAACTTTAACAAGCAAATAAGG + Intergenic
932864435 2:75326832-75326854 CAAACTGACCCAAGGGAATAAGG + Intergenic
933742908 2:85548809-85548831 CTAAATTTAGTAAGGGATTAGGG - Exonic
937084325 2:119160479-119160501 CCAACTTTACCAAGGAGAGAAGG + Intergenic
937388289 2:121457324-121457346 CTGCCTTTACTCAGGGAATAGGG + Intronic
942310469 2:174652145-174652167 CTACTTTGACCAAGGGAGTACGG - Intronic
944414953 2:199471237-199471259 CTTAAGTTACCAAGGGATTAGGG - Intronic
1172403209 20:34667892-34667914 CTACATTAACCAAGGGATTATGG + Intronic
1172613568 20:36268499-36268521 CTACCTTTGCCAGGGGAATGGGG - Intronic
1172919741 20:38471538-38471560 CAAACTTCTCCAAGGGAAGAAGG + Intergenic
1178447038 21:32654657-32654679 CTAACTTTAACAAGGGATTCTGG + Intronic
1179012839 21:37569593-37569615 TTCATTTTACCAAGGGCATAGGG - Intergenic
1179108208 21:38422418-38422440 CCAACTTTTCCAAGGGCATTAGG - Intronic
1183825385 22:40382614-40382636 CTCCCTTAACCAAGAGAATATGG - Intronic
1184199596 22:42958257-42958279 CTCACTTTACCAAAGGAATTGGG - Intronic
1185166418 22:49265263-49265285 CTAACTTTACCAAGGGAATAGGG - Intergenic
949799859 3:7891952-7891974 CTAACTTTGCAAAGAGAAAATGG - Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950777447 3:15362872-15362894 CTAATTTGACCAAGGGCATAGGG + Intergenic
959065745 3:101655212-101655234 GTTACTTTACCAAGGGGACATGG + Intronic
959580587 3:107978800-107978822 ATAACTTGCCCAAGGTAATAAGG + Intergenic
960084606 3:113577034-113577056 CTAACTCTACCAGGGTAACATGG - Intronic
961587763 3:127948083-127948105 ATAATTTTACAAAGGGAAAAAGG + Intronic
962568334 3:136686973-136686995 CTAACTGATCCAAGGGAAAAAGG + Intronic
962962882 3:140327526-140327548 CAAACTTTAGAAAGGGAATTGGG + Intronic
963822520 3:149913824-149913846 CTACCTTAACCAAGGGATGAAGG - Intronic
965019453 3:163209474-163209496 CTAATTTTATCCAGGGAAAAAGG - Intergenic
967078880 3:186030458-186030480 CTAACTTTATCAAGAAAAAAAGG - Intergenic
970297081 4:14641496-14641518 CTAACTCTACCAAGAGGAAAAGG + Intergenic
970342240 4:15119346-15119368 CTTGCTTGACCAAGAGAATATGG - Intergenic
972169706 4:36330668-36330690 ATAACTTCTCCAAGGTAATATGG - Intronic
972572574 4:40324249-40324271 CTACCTTGACCAAGAGAAGAAGG + Intergenic
976380764 4:84395601-84395623 GCAACTTTGCCAAGGGACTAGGG - Intergenic
979870883 4:125820257-125820279 CTAATTTTATTCAGGGAATAAGG - Intergenic
980062221 4:128143327-128143349 CTAACTTGTGCAAGGGATTATGG - Intronic
981112201 4:140948443-140948465 CTAACTTGGCCTAGGGAATAAGG + Intronic
981457834 4:144976681-144976703 CTAACTCTACAAAGAGCATATGG + Intronic
981534268 4:145782956-145782978 CTAACTCTACCTTGGGAATTGGG - Intronic
981737370 4:147967181-147967203 CTAACTTTATCAAGAGTACAGGG - Intronic
982654804 4:158134736-158134758 CTAACACTACCAAAGGAAAATGG - Intronic
983584780 4:169343104-169343126 CCAACTTAACCAATGGAATTTGG - Intergenic
984467368 4:180117855-180117877 TGAACTTTTCCAAGGGCATAAGG - Intergenic
987658225 5:20836756-20836778 CTAACTATACCAAATGATTAAGG - Intergenic
988765460 5:34369179-34369201 CTAACTATACCAAATGATTAAGG + Intergenic
990981857 5:61608772-61608794 CTAGCCCTACCAAGAGAATACGG - Intergenic
992176455 5:74154072-74154094 TTAAATGTACCAAGGGAATGAGG + Intergenic
993174242 5:84461754-84461776 CCAAAATGACCAAGGGAATAAGG - Intergenic
993348678 5:86819548-86819570 CTAACATCACCAAGCTAATAAGG - Intergenic
993414340 5:87607941-87607963 CAATCTTTACCTAGGGAACAGGG - Intergenic
996228956 5:121037627-121037649 ATAACCCTACGAAGGGAATATGG + Intergenic
997373667 5:133381952-133381974 CTTACTTTTCCAAGGAAATGGGG + Intronic
999118146 5:149183077-149183099 CAAACTTGTCCAAGGGAATTTGG - Intronic
1001669887 5:173464875-173464897 CTAACTTTGCCATGGCGATATGG + Intergenic
1002457171 5:179351762-179351784 TTAACTTTCCCAAGGGCACACGG - Intergenic
1005563904 6:27069562-27069584 CTGACTTTGCCAAAGGAAAAGGG + Intergenic
1007101874 6:39254218-39254240 CCAACTTGACCAAGGGACAAAGG - Intergenic
1007303117 6:40883450-40883472 CTAACTTGTCCAAGGCAACATGG + Intergenic
1008840365 6:55895521-55895543 CTAAATATACAAAGGAAATAAGG - Intergenic
1008953971 6:57193796-57193818 TTAACTTTACCAAGTAAACATGG + Intronic
1010757316 6:79681452-79681474 CTCAATTAACCAAGGCAATATGG - Intronic
1015127422 6:129770283-129770305 GTAACTTTTCCAAGAAAATATGG + Intergenic
1020465645 7:8475588-8475610 CTAACTGCAACAAGGGAATCGGG + Intronic
1021586568 7:22214982-22215004 CTAACTTTTCCTAAGGAAGATGG - Intronic
1022135243 7:27441352-27441374 CTACCCTGACCAATGGAATATGG - Intergenic
1026231135 7:68485104-68485126 CTAACTTTGCCAAGTGCAAACGG + Intergenic
1030920141 7:115374008-115374030 CTAACCTAATCAAGGGAAAAAGG + Intergenic
1031305892 7:120126888-120126910 CTAATTTTGACAGGGGAATATGG + Intergenic
1034152488 7:148928038-148928060 CTAAATTTAAAAAGGGAATTGGG + Intergenic
1034735394 7:153424888-153424910 CAAGCTTAACCAAGGGAATTAGG + Intergenic
1036588095 8:10143637-10143659 CTAACTTTTGCAAGGAAATCAGG + Intronic
1038723090 8:30055572-30055594 CTCCCTTTACCAAGGTAGTAAGG - Intergenic
1039215715 8:35268104-35268126 CTAAGTTTTCTAAGGGAATATGG - Intronic
1044136329 8:88590891-88590913 ATAACTTTACCAAGGGCCTGTGG + Intergenic
1045666108 8:104486728-104486750 CTACCTTTATCAAGAAAATAAGG + Intergenic
1046375330 8:113372308-113372330 CTAAGTTTACCAACCTAATATGG - Intronic
1046417185 8:113932939-113932961 CTAATTATATTAAGGGAATACGG - Intergenic
1046832401 8:118761009-118761031 AAAACTTTACCAGGAGAATAAGG - Intergenic
1051934570 9:22430964-22430986 CTAACTCTACCATGTAAATAGGG - Intergenic
1052250752 9:26394348-26394370 CCATCTTTACCATGGGACTAGGG - Intergenic
1058874853 9:109235315-109235337 CTAAGTTTACAAAGGGAAAGGGG - Intronic
1188335812 X:28931467-28931489 CTAATTTTAACAATGGAATTTGG - Intronic
1188777675 X:34241356-34241378 CTAACTGTAGCAAGCAAATAGGG + Intergenic
1194141986 X:90219321-90219343 CTAACCCTAGCAAGGGAAGAAGG - Intergenic
1194577063 X:95626227-95626249 CTAACTTGACCAGGTGAACAAGG + Intergenic
1196041495 X:111209627-111209649 CTCACTTTACAAAGAGGATAGGG - Intronic
1197229286 X:123986265-123986287 CTAACTTTATAAAGCTAATATGG + Intronic
1197587961 X:128373206-128373228 CTAAATATACCAAGGAAACAAGG - Intergenic
1199375925 X:147109421-147109443 CTAACCCTACGAAGAGAATAGGG + Intergenic
1199457245 X:148043247-148043269 ATAACTTCACCAACTGAATAAGG - Intergenic
1200170529 X:154070269-154070291 CTGTCTTGTCCAAGGGAATAGGG - Intronic
1200487746 Y:3788434-3788456 CTAACCCTAGCAAGGGAAGAAGG - Intergenic
1200858860 Y:7968553-7968575 GTCACTTTACCAAGGTGATAGGG + Intergenic