ID: 1185167013

View in Genome Browser
Species Human (GRCh38)
Location 22:49267414-49267436
Sequence AGCGTCCGGCCATCACGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185167009_1185167013 10 Left 1185167009 22:49267381-49267403 CCGGGCTGCGGTGTGCAGTGTGG No data
Right 1185167013 22:49267414-49267436 AGCGTCCGGCCATCACGTGCGGG No data
1185167007_1185167013 14 Left 1185167007 22:49267377-49267399 CCTCCCGGGCTGCGGTGTGCAGT No data
Right 1185167013 22:49267414-49267436 AGCGTCCGGCCATCACGTGCGGG No data
1185167006_1185167013 15 Left 1185167006 22:49267376-49267398 CCCTCCCGGGCTGCGGTGTGCAG No data
Right 1185167013 22:49267414-49267436 AGCGTCCGGCCATCACGTGCGGG No data
1185167008_1185167013 11 Left 1185167008 22:49267380-49267402 CCCGGGCTGCGGTGTGCAGTGTG No data
Right 1185167013 22:49267414-49267436 AGCGTCCGGCCATCACGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185167013 Original CRISPR AGCGTCCGGCCATCACGTGC GGG Intergenic
No off target data available for this crispr