ID: 1185168751

View in Genome Browser
Species Human (GRCh38)
Location 22:49278639-49278661
Sequence CTCTATTTGCATTCGCAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185168751_1185168756 9 Left 1185168751 22:49278639-49278661 CCGGGCTGCGAATGCAAATAGAG No data
Right 1185168756 22:49278671-49278693 CTAATTGCTGCTGTCAAGCCTGG No data
1185168751_1185168757 10 Left 1185168751 22:49278639-49278661 CCGGGCTGCGAATGCAAATAGAG No data
Right 1185168757 22:49278672-49278694 TAATTGCTGCTGTCAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185168751 Original CRISPR CTCTATTTGCATTCGCAGCC CGG (reversed) Intergenic
No off target data available for this crispr