ID: 1185170509

View in Genome Browser
Species Human (GRCh38)
Location 22:49291060-49291082
Sequence TGCTAAGGGTAGAGTAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185170509_1185170512 -10 Left 1185170509 22:49291060-49291082 CCCTCCTTACTCTACCCTTAGCA No data
Right 1185170512 22:49291073-49291095 ACCCTTAGCAGAAATCCTTGAGG No data
1185170509_1185170520 20 Left 1185170509 22:49291060-49291082 CCCTCCTTACTCTACCCTTAGCA No data
Right 1185170520 22:49291103-49291125 GGCTTCCTTCTCCCGGGACAAGG No data
1185170509_1185170515 -5 Left 1185170509 22:49291060-49291082 CCCTCCTTACTCTACCCTTAGCA No data
Right 1185170515 22:49291078-49291100 TAGCAGAAATCCTTGAGGCTTGG No data
1185170509_1185170516 -1 Left 1185170509 22:49291060-49291082 CCCTCCTTACTCTACCCTTAGCA No data
Right 1185170516 22:49291082-49291104 AGAAATCCTTGAGGCTTGGCTGG No data
1185170509_1185170518 13 Left 1185170509 22:49291060-49291082 CCCTCCTTACTCTACCCTTAGCA No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data
1185170509_1185170519 14 Left 1185170509 22:49291060-49291082 CCCTCCTTACTCTACCCTTAGCA No data
Right 1185170519 22:49291097-49291119 TTGGCTGGCTTCCTTCTCCCGGG No data
1185170509_1185170522 26 Left 1185170509 22:49291060-49291082 CCCTCCTTACTCTACCCTTAGCA No data
Right 1185170522 22:49291109-49291131 CTTCTCCCGGGACAAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185170509 Original CRISPR TGCTAAGGGTAGAGTAAGGA GGG (reversed) Intergenic
No off target data available for this crispr