ID: 1185170510

View in Genome Browser
Species Human (GRCh38)
Location 22:49291061-49291083
Sequence CTGCTAAGGGTAGAGTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185170510_1185170516 -2 Left 1185170510 22:49291061-49291083 CCTCCTTACTCTACCCTTAGCAG No data
Right 1185170516 22:49291082-49291104 AGAAATCCTTGAGGCTTGGCTGG No data
1185170510_1185170519 13 Left 1185170510 22:49291061-49291083 CCTCCTTACTCTACCCTTAGCAG No data
Right 1185170519 22:49291097-49291119 TTGGCTGGCTTCCTTCTCCCGGG No data
1185170510_1185170520 19 Left 1185170510 22:49291061-49291083 CCTCCTTACTCTACCCTTAGCAG No data
Right 1185170520 22:49291103-49291125 GGCTTCCTTCTCCCGGGACAAGG No data
1185170510_1185170515 -6 Left 1185170510 22:49291061-49291083 CCTCCTTACTCTACCCTTAGCAG No data
Right 1185170515 22:49291078-49291100 TAGCAGAAATCCTTGAGGCTTGG No data
1185170510_1185170522 25 Left 1185170510 22:49291061-49291083 CCTCCTTACTCTACCCTTAGCAG No data
Right 1185170522 22:49291109-49291131 CTTCTCCCGGGACAAGGATGAGG No data
1185170510_1185170518 12 Left 1185170510 22:49291061-49291083 CCTCCTTACTCTACCCTTAGCAG No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185170510 Original CRISPR CTGCTAAGGGTAGAGTAAGG AGG (reversed) Intergenic
No off target data available for this crispr