ID: 1185170513

View in Genome Browser
Species Human (GRCh38)
Location 22:49291074-49291096
Sequence GCCTCAAGGATTTCTGCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185170513_1185170522 12 Left 1185170513 22:49291074-49291096 CCCTTAGCAGAAATCCTTGAGGC No data
Right 1185170522 22:49291109-49291131 CTTCTCCCGGGACAAGGATGAGG No data
1185170513_1185170526 22 Left 1185170513 22:49291074-49291096 CCCTTAGCAGAAATCCTTGAGGC No data
Right 1185170526 22:49291119-49291141 GACAAGGATGAGGAGATACAGGG No data
1185170513_1185170520 6 Left 1185170513 22:49291074-49291096 CCCTTAGCAGAAATCCTTGAGGC No data
Right 1185170520 22:49291103-49291125 GGCTTCCTTCTCCCGGGACAAGG No data
1185170513_1185170519 0 Left 1185170513 22:49291074-49291096 CCCTTAGCAGAAATCCTTGAGGC No data
Right 1185170519 22:49291097-49291119 TTGGCTGGCTTCCTTCTCCCGGG No data
1185170513_1185170518 -1 Left 1185170513 22:49291074-49291096 CCCTTAGCAGAAATCCTTGAGGC No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data
1185170513_1185170525 21 Left 1185170513 22:49291074-49291096 CCCTTAGCAGAAATCCTTGAGGC No data
Right 1185170525 22:49291118-49291140 GGACAAGGATGAGGAGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185170513 Original CRISPR GCCTCAAGGATTTCTGCTAA GGG (reversed) Intergenic
No off target data available for this crispr