ID: 1185170514

View in Genome Browser
Species Human (GRCh38)
Location 22:49291075-49291097
Sequence AGCCTCAAGGATTTCTGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185170514_1185170522 11 Left 1185170514 22:49291075-49291097 CCTTAGCAGAAATCCTTGAGGCT No data
Right 1185170522 22:49291109-49291131 CTTCTCCCGGGACAAGGATGAGG No data
1185170514_1185170525 20 Left 1185170514 22:49291075-49291097 CCTTAGCAGAAATCCTTGAGGCT No data
Right 1185170525 22:49291118-49291140 GGACAAGGATGAGGAGATACAGG No data
1185170514_1185170520 5 Left 1185170514 22:49291075-49291097 CCTTAGCAGAAATCCTTGAGGCT No data
Right 1185170520 22:49291103-49291125 GGCTTCCTTCTCCCGGGACAAGG No data
1185170514_1185170518 -2 Left 1185170514 22:49291075-49291097 CCTTAGCAGAAATCCTTGAGGCT No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data
1185170514_1185170526 21 Left 1185170514 22:49291075-49291097 CCTTAGCAGAAATCCTTGAGGCT No data
Right 1185170526 22:49291119-49291141 GACAAGGATGAGGAGATACAGGG No data
1185170514_1185170519 -1 Left 1185170514 22:49291075-49291097 CCTTAGCAGAAATCCTTGAGGCT No data
Right 1185170519 22:49291097-49291119 TTGGCTGGCTTCCTTCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185170514 Original CRISPR AGCCTCAAGGATTTCTGCTA AGG (reversed) Intergenic
No off target data available for this crispr