ID: 1185170518

View in Genome Browser
Species Human (GRCh38)
Location 22:49291096-49291118
Sequence CTTGGCTGGCTTCCTTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185170509_1185170518 13 Left 1185170509 22:49291060-49291082 CCCTCCTTACTCTACCCTTAGCA No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data
1185170513_1185170518 -1 Left 1185170513 22:49291074-49291096 CCCTTAGCAGAAATCCTTGAGGC No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data
1185170514_1185170518 -2 Left 1185170514 22:49291075-49291097 CCTTAGCAGAAATCCTTGAGGCT No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data
1185170510_1185170518 12 Left 1185170510 22:49291061-49291083 CCTCCTTACTCTACCCTTAGCAG No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data
1185170511_1185170518 9 Left 1185170511 22:49291064-49291086 CCTTACTCTACCCTTAGCAGAAA No data
Right 1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185170518 Original CRISPR CTTGGCTGGCTTCCTTCTCC CGG Intergenic
No off target data available for this crispr