ID: 1185171578

View in Genome Browser
Species Human (GRCh38)
Location 22:49297581-49297603
Sequence CCTTCTCTGCAGGGGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185171578_1185171584 -10 Left 1185171578 22:49297581-49297603 CCAGGCACCCCCTGCAGAGAAGG No data
Right 1185171584 22:49297594-49297616 GCAGAGAAGGCAAAGCAGCCTGG No data
1185171578_1185171586 2 Left 1185171578 22:49297581-49297603 CCAGGCACCCCCTGCAGAGAAGG No data
Right 1185171586 22:49297606-49297628 AAGCAGCCTGGGAGCCGCAGAGG No data
1185171578_1185171585 -9 Left 1185171578 22:49297581-49297603 CCAGGCACCCCCTGCAGAGAAGG No data
Right 1185171585 22:49297595-49297617 CAGAGAAGGCAAAGCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185171578 Original CRISPR CCTTCTCTGCAGGGGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr