ID: 1185172587

View in Genome Browser
Species Human (GRCh38)
Location 22:49302431-49302453
Sequence GTTGTTTTGAGAATAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185172583_1185172587 21 Left 1185172583 22:49302387-49302409 CCTGCTTATCACCTGCAAAGTGA No data
Right 1185172587 22:49302431-49302453 GTTGTTTTGAGAATAAAACCAGG No data
1185172581_1185172587 30 Left 1185172581 22:49302378-49302400 CCCTGGGCTCCTGCTTATCACCT No data
Right 1185172587 22:49302431-49302453 GTTGTTTTGAGAATAAAACCAGG No data
1185172584_1185172587 10 Left 1185172584 22:49302398-49302420 CCTGCAAAGTGAAGATAATGTCT No data
Right 1185172587 22:49302431-49302453 GTTGTTTTGAGAATAAAACCAGG No data
1185172582_1185172587 29 Left 1185172582 22:49302379-49302401 CCTGGGCTCCTGCTTATCACCTG No data
Right 1185172587 22:49302431-49302453 GTTGTTTTGAGAATAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185172587 Original CRISPR GTTGTTTTGAGAATAAAACC AGG Intergenic
No off target data available for this crispr