ID: 1185173084

View in Genome Browser
Species Human (GRCh38)
Location 22:49304752-49304774
Sequence GCTCCCAAGGGACCCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185173078_1185173084 12 Left 1185173078 22:49304717-49304739 CCAGGCAGTGCAGCCCAGTCTCA No data
Right 1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG No data
1185173076_1185173084 19 Left 1185173076 22:49304710-49304732 CCGAGGCCCAGGCAGTGCAGCCC No data
Right 1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG No data
1185173077_1185173084 13 Left 1185173077 22:49304716-49304738 CCCAGGCAGTGCAGCCCAGTCTC No data
Right 1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG No data
1185173079_1185173084 -1 Left 1185173079 22:49304730-49304752 CCCAGTCTCACCTCTGCACGCAG No data
Right 1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG No data
1185173075_1185173084 20 Left 1185173075 22:49304709-49304731 CCCGAGGCCCAGGCAGTGCAGCC No data
Right 1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG No data
1185173080_1185173084 -2 Left 1185173080 22:49304731-49304753 CCAGTCTCACCTCTGCACGCAGC No data
Right 1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185173084 Original CRISPR GCTCCCAAGGGACCCCAAGA AGG Intergenic
No off target data available for this crispr