ID: 1185178999

View in Genome Browser
Species Human (GRCh38)
Location 22:49348643-49348665
Sequence GTTCCCAGGTGTGTGAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185178999_1185179012 25 Left 1185178999 22:49348643-49348665 CCGTCTCTCACACACCTGGGAAC No data
Right 1185179012 22:49348691-49348713 AGCCACCATGCAGGGGAGAGAGG No data
1185178999_1185179013 26 Left 1185178999 22:49348643-49348665 CCGTCTCTCACACACCTGGGAAC No data
Right 1185179013 22:49348692-49348714 GCCACCATGCAGGGGAGAGAGGG No data
1185178999_1185179007 17 Left 1185178999 22:49348643-49348665 CCGTCTCTCACACACCTGGGAAC No data
Right 1185179007 22:49348683-49348705 CCCCCTGCAGCCACCATGCAGGG No data
1185178999_1185179005 16 Left 1185178999 22:49348643-49348665 CCGTCTCTCACACACCTGGGAAC No data
Right 1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG No data
1185178999_1185179009 18 Left 1185178999 22:49348643-49348665 CCGTCTCTCACACACCTGGGAAC No data
Right 1185179009 22:49348684-49348706 CCCCTGCAGCCACCATGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185178999 Original CRISPR GTTCCCAGGTGTGTGAGAGA CGG (reversed) Intergenic
No off target data available for this crispr