ID: 1185179000

View in Genome Browser
Species Human (GRCh38)
Location 22:49348657-49348679
Sequence AGGAGGGGCAGCTTGTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185179000_1185179009 4 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179009 22:49348684-49348706 CCCCTGCAGCCACCATGCAGGGG No data
1185179000_1185179016 24 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179016 22:49348704-49348726 GGGAGAGAGGGAAACCAGAGTGG No data
1185179000_1185179017 25 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179017 22:49348705-49348727 GGAGAGAGGGAAACCAGAGTGGG No data
1185179000_1185179018 30 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179018 22:49348710-49348732 GAGGGAAACCAGAGTGGGCTTGG No data
1185179000_1185179007 3 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179007 22:49348683-49348705 CCCCCTGCAGCCACCATGCAGGG No data
1185179000_1185179013 12 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179013 22:49348692-49348714 GCCACCATGCAGGGGAGAGAGGG No data
1185179000_1185179012 11 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179012 22:49348691-49348713 AGCCACCATGCAGGGGAGAGAGG No data
1185179000_1185179005 2 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185179000 Original CRISPR AGGAGGGGCAGCTTGTTCCC AGG (reversed) Intergenic
No off target data available for this crispr