ID: 1185179005

View in Genome Browser
Species Human (GRCh38)
Location 22:49348682-49348704
Sequence GCCCCCTGCAGCCACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185178999_1185179005 16 Left 1185178999 22:49348643-49348665 CCGTCTCTCACACACCTGGGAAC No data
Right 1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG No data
1185179000_1185179005 2 Left 1185179000 22:49348657-49348679 CCTGGGAACAAGCTGCCCCTCCT No data
Right 1185179005 22:49348682-49348704 GCCCCCTGCAGCCACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185179005 Original CRISPR GCCCCCTGCAGCCACCATGC AGG Intergenic
No off target data available for this crispr