ID: 1185182025

View in Genome Browser
Species Human (GRCh38)
Location 22:49369147-49369169
Sequence GTGCTGTCCAGGAGCCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185182025_1185182030 7 Left 1185182025 22:49369147-49369169 CCCACGTGGCTCCTGGACAGCAC No data
Right 1185182030 22:49369177-49369199 AGCCTCTGCTACTGTGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185182025 Original CRISPR GTGCTGTCCAGGAGCCACGT GGG (reversed) Intergenic
No off target data available for this crispr