ID: 1185185669

View in Genome Browser
Species Human (GRCh38)
Location 22:49398243-49398265
Sequence GCCAGGGGGTATGCAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185185669_1185185685 13 Left 1185185669 22:49398243-49398265 CCGCCCGCTGCATACCCCCTGGC No data
Right 1185185685 22:49398279-49398301 CCTGACGGGGCCCTGGGCTTTGG No data
1185185669_1185185680 0 Left 1185185669 22:49398243-49398265 CCGCCCGCTGCATACCCCCTGGC No data
Right 1185185680 22:49398266-49398288 CGGCTTCTCTCCTCCTGACGGGG No data
1185185669_1185185677 -2 Left 1185185669 22:49398243-49398265 CCGCCCGCTGCATACCCCCTGGC No data
Right 1185185677 22:49398264-49398286 GCCGGCTTCTCTCCTCCTGACGG No data
1185185669_1185185682 7 Left 1185185669 22:49398243-49398265 CCGCCCGCTGCATACCCCCTGGC No data
Right 1185185682 22:49398273-49398295 TCTCCTCCTGACGGGGCCCTGGG No data
1185185669_1185185679 -1 Left 1185185669 22:49398243-49398265 CCGCCCGCTGCATACCCCCTGGC No data
Right 1185185679 22:49398265-49398287 CCGGCTTCTCTCCTCCTGACGGG No data
1185185669_1185185681 6 Left 1185185669 22:49398243-49398265 CCGCCCGCTGCATACCCCCTGGC No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185185669 Original CRISPR GCCAGGGGGTATGCAGCGGG CGG (reversed) Intergenic