ID: 1185185675

View in Genome Browser
Species Human (GRCh38)
Location 22:49398259-49398281
Sequence AGGAGGAGAGAAGCCGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185185675_1185185682 -9 Left 1185185675 22:49398259-49398281 CCCTGGCCGGCTTCTCTCCTCCT No data
Right 1185185682 22:49398273-49398295 TCTCCTCCTGACGGGGCCCTGGG No data
1185185675_1185185685 -3 Left 1185185675 22:49398259-49398281 CCCTGGCCGGCTTCTCTCCTCCT No data
Right 1185185685 22:49398279-49398301 CCTGACGGGGCCCTGGGCTTTGG No data
1185185675_1185185681 -10 Left 1185185675 22:49398259-49398281 CCCTGGCCGGCTTCTCTCCTCCT No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185185675 Original CRISPR AGGAGGAGAGAAGCCGGCCA GGG (reversed) Intergenic