ID: 1185185676

View in Genome Browser
Species Human (GRCh38)
Location 22:49398260-49398282
Sequence CAGGAGGAGAGAAGCCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185185676_1185185682 -10 Left 1185185676 22:49398260-49398282 CCTGGCCGGCTTCTCTCCTCCTG No data
Right 1185185682 22:49398273-49398295 TCTCCTCCTGACGGGGCCCTGGG No data
1185185676_1185185685 -4 Left 1185185676 22:49398260-49398282 CCTGGCCGGCTTCTCTCCTCCTG No data
Right 1185185685 22:49398279-49398301 CCTGACGGGGCCCTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185185676 Original CRISPR CAGGAGGAGAGAAGCCGGCC AGG (reversed) Intergenic