ID: 1185185677

View in Genome Browser
Species Human (GRCh38)
Location 22:49398264-49398286
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185185669_1185185677 -2 Left 1185185669 22:49398243-49398265 CCGCCCGCTGCATACCCCCTGGC No data
Right 1185185677 22:49398264-49398286 GCCGGCTTCTCTCCTCCTGACGG No data
1185185672_1185185677 -6 Left 1185185672 22:49398247-49398269 CCGCTGCATACCCCCTGGCCGGC No data
Right 1185185677 22:49398264-49398286 GCCGGCTTCTCTCCTCCTGACGG No data
1185185670_1185185677 -5 Left 1185185670 22:49398246-49398268 CCCGCTGCATACCCCCTGGCCGG No data
Right 1185185677 22:49398264-49398286 GCCGGCTTCTCTCCTCCTGACGG No data
1185185667_1185185677 10 Left 1185185667 22:49398231-49398253 CCAAAAGCTCTGCCGCCCGCTGC No data
Right 1185185677 22:49398264-49398286 GCCGGCTTCTCTCCTCCTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185185677 Original CRISPR GCCGGCTTCTCTCCTCCTGA CGG Intergenic