ID: 1185185678

View in Genome Browser
Species Human (GRCh38)
Location 22:49398265-49398287
Sequence CCCGTCAGGAGGAGAGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185185678_1185185685 -9 Left 1185185678 22:49398265-49398287 CCGGCTTCTCTCCTCCTGACGGG No data
Right 1185185685 22:49398279-49398301 CCTGACGGGGCCCTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185185678 Original CRISPR CCCGTCAGGAGGAGAGAAGC CGG (reversed) Intergenic