ID: 1185185681

View in Genome Browser
Species Human (GRCh38)
Location 22:49398272-49398294
Sequence CTCTCCTCCTGACGGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185185672_1185185681 2 Left 1185185672 22:49398247-49398269 CCGCTGCATACCCCCTGGCCGGC No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data
1185185675_1185185681 -10 Left 1185185675 22:49398259-49398281 CCCTGGCCGGCTTCTCTCCTCCT No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data
1185185670_1185185681 3 Left 1185185670 22:49398246-49398268 CCCGCTGCATACCCCCTGGCCGG No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data
1185185673_1185185681 -8 Left 1185185673 22:49398257-49398279 CCCCCTGGCCGGCTTCTCTCCTC No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data
1185185669_1185185681 6 Left 1185185669 22:49398243-49398265 CCGCCCGCTGCATACCCCCTGGC No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data
1185185674_1185185681 -9 Left 1185185674 22:49398258-49398280 CCCCTGGCCGGCTTCTCTCCTCC No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data
1185185667_1185185681 18 Left 1185185667 22:49398231-49398253 CCAAAAGCTCTGCCGCCCGCTGC No data
Right 1185185681 22:49398272-49398294 CTCTCCTCCTGACGGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185185681 Original CRISPR CTCTCCTCCTGACGGGGCCC TGG Intergenic