ID: 1185188186

View in Genome Browser
Species Human (GRCh38)
Location 22:49415792-49415814
Sequence AAGCAGTTCTGCATGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185188183_1185188186 0 Left 1185188183 22:49415769-49415791 CCTGTGTTTCTTCTTCAAGGGAG 0: 1
1: 0
2: 3
3: 17
4: 231
Right 1185188186 22:49415792-49415814 AAGCAGTTCTGCATGGGCCATGG 0: 1
1: 0
2: 1
3: 12
4: 162
1185188179_1185188186 22 Left 1185188179 22:49415747-49415769 CCTTTTACAGCTGAGCCAATAGC 0: 2
1: 0
2: 0
3: 10
4: 115
Right 1185188186 22:49415792-49415814 AAGCAGTTCTGCATGGGCCATGG 0: 1
1: 0
2: 1
3: 12
4: 162
1185188180_1185188186 7 Left 1185188180 22:49415762-49415784 CCAATAGCCTGTGTTTCTTCTTC 0: 1
1: 0
2: 3
3: 39
4: 382
Right 1185188186 22:49415792-49415814 AAGCAGTTCTGCATGGGCCATGG 0: 1
1: 0
2: 1
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185188186 Original CRISPR AAGCAGTTCTGCATGGGCCA TGG Intronic
900284890 1:1894340-1894362 TAGGATTTCTGCCTGGGCCATGG - Intergenic
902559071 1:17265723-17265745 AAGCATCTCTGCCTGGGCCCAGG + Intronic
902917187 1:19645792-19645814 TAGGTGTTCTGCATCGGCCAGGG + Intronic
906424447 1:45698465-45698487 AAGCAGTTTTGTTTGGGTCAAGG + Intronic
907045379 1:51297153-51297175 AAGCTGGTCTTCGTGGGCCACGG + Intronic
907251874 1:53145072-53145094 ATACAGTGCTGCATGCGCCATGG + Intergenic
907283470 1:53365844-53365866 AAGCCGTTCTGGAGGTGCCAGGG - Intergenic
915627907 1:157127067-157127089 GAGAAGCTCTGCTTGGGCCAAGG + Intronic
916505388 1:165423745-165423767 AAGCAGATCTGGTTGAGCCAGGG - Intronic
916812776 1:168319946-168319968 GAGCAGGGCTTCATGGGCCAGGG + Intergenic
917627890 1:176864122-176864144 AAGAAGTTCTGCAGGGAGCAAGG + Exonic
922068775 1:222170318-222170340 GAACAGGTCTGCATGTGCCATGG + Intergenic
922552571 1:226506912-226506934 AAGCTGTCCTCCATTGGCCAAGG - Intergenic
922652430 1:227352788-227352810 AAGCAGTTATGCATGAGGGAGGG - Intergenic
923263186 1:232286786-232286808 AAGCAGGACTGCTTGAGCCAAGG + Intergenic
923504529 1:234594070-234594092 AAGCAGTTCTCCTTGTGGCAGGG - Intergenic
923582930 1:235235732-235235754 AAGGAGAACTGCATGAGCCATGG + Intronic
923976495 1:239270319-239270341 AAGTAGATCTGCATGAGACAAGG - Intergenic
924669701 1:246111069-246111091 AAGATGTTATGCATGGGTCAGGG - Intronic
924853211 1:247851611-247851633 AAGCCGTTCCGCAAGGGCCCTGG + Intergenic
1063777854 10:9284344-9284366 CAGCAGTACTTCATAGGCCAGGG - Intergenic
1067134307 10:43594688-43594710 AGGCACTTCTGCAAGGGCTAAGG - Intergenic
1067581221 10:47447321-47447343 AATCACTTCTGCAGTGGCCATGG - Intergenic
1068124209 10:52818009-52818031 AAGCAGTTCTGAATTGACCTTGG + Intergenic
1068127676 10:52861804-52861826 ACACAGTTATGCATGTGCCATGG + Intergenic
1068738084 10:60437441-60437463 CTGCAGTGCTGCAGGGGCCAGGG + Intronic
1069543874 10:69315661-69315683 CAGCAGTGCAGCATGGGCCCTGG + Intronic
1070702660 10:78614873-78614895 AAGCAGTGCTGGATGGAGCAGGG - Intergenic
1074143414 10:110696661-110696683 AGGAAGTACTGCCTGGGCCATGG + Intronic
1075576346 10:123580457-123580479 AAGAAATTCTTCCTGGGCCAGGG + Intergenic
1075621381 10:123930435-123930457 ACGCAGTTCTCCCTGTGCCAGGG + Intronic
1077102634 11:828942-828964 AGGGAGTTCTGCCTGGGCCTGGG + Exonic
1077150985 11:1073112-1073134 AGGCAGCCCTGCATGGGGCAGGG - Intergenic
1077286673 11:1769271-1769293 AAGGAGTTCTGCTTGGGGAAAGG - Intergenic
1078733742 11:14000745-14000767 AAGCTGTTTTGGAGGGGCCAGGG - Intronic
1079243354 11:18736313-18736335 AAGCAGTGCTGCCTGGCACATGG - Intronic
1080188657 11:29520871-29520893 AAGCACTTCTGCAAGGGCTAAGG + Intergenic
1081126146 11:39325017-39325039 AAGCAGCTCTGCTTGTGCCTAGG - Intergenic
1083322288 11:61855151-61855173 AGGCAGGTCAGCAGGGGCCAGGG - Intronic
1090985672 11:131763661-131763683 AAGCAGAGCAGCATGGGCCTGGG - Intronic
1093685337 12:22047610-22047632 AAGAAGTCCTGGATGGACCAAGG + Intronic
1096219032 12:49816273-49816295 CACCAGTTCTGCAGGGGGCAGGG - Intronic
1096529719 12:52234951-52234973 AAGCAGGTCTGCCTGGTGCACGG - Intronic
1101641023 12:106585880-106585902 GAACAGTTTTGCAGGGGCCAGGG + Intronic
1105277212 13:18943333-18943355 AAGAAGTTCCCCATGGGACAGGG - Intergenic
1107549518 13:41461907-41461929 TAGCAATTCTGCATGGGTAATGG + Intronic
1108728095 13:53202555-53202577 GAGCAGGACTGCATGGGCCCAGG + Intergenic
1116325881 14:43533439-43533461 AGGCAGCTCCGCCTGGGCCATGG + Intergenic
1120942696 14:89963994-89964016 TAGTAGTTCTCCATGGGCCCTGG + Intronic
1121428862 14:93873088-93873110 CAACAGTTCTGCATGCCCCAGGG - Intergenic
1121506168 14:94479250-94479272 AGGTAGTTCTGCATGGGACCTGG - Intronic
1121795749 14:96733782-96733804 AAGCGGTTCTGAATGTGGCATGG + Intergenic
1122140988 14:99662925-99662947 AGTGAGATCTGCATGGGCCACGG + Exonic
1124143088 15:27094588-27094610 AAGCAGTTCTGCAGGGAGCAGGG + Intronic
1126620016 15:50629237-50629259 AACCATTTCTCCATGTGCCATGG + Intronic
1128219349 15:65957377-65957399 AAGCTGTTCTCAAAGGGCCAGGG - Intronic
1129383167 15:75180596-75180618 AGGGAGTTCTGTGTGGGCCAAGG + Intergenic
1132246031 15:100297066-100297088 AGGCAGTGATGCAAGGGCCAAGG + Intronic
1135071349 16:19354675-19354697 AGGCAGTTCTCCACGGGACATGG + Intergenic
1141204343 16:81921888-81921910 AAACAGATCTGCATTGGCCATGG - Intronic
1144668883 17:17120308-17120330 AAGTGCTTCTGCTTGGGCCAGGG + Intronic
1145223638 17:21109477-21109499 AACCATTTCTTCTTGGGCCATGG - Intergenic
1147346469 17:39799549-39799571 AAGCAGTTCTGCAACCGCCTGGG + Intronic
1148074590 17:44928173-44928195 GAGCAGTTCTGCATGGCGGAAGG + Exonic
1148085978 17:44994120-44994142 TAGAAGTGCTGCATGGGACATGG - Intergenic
1148129215 17:45253072-45253094 GAGCAGTTCAGAATGGGCCAGGG - Intergenic
1148471102 17:47894013-47894035 AAGCTCTTTTGCATGTGCCAGGG + Intergenic
1148763175 17:50019589-50019611 CAGCACTTCTGCCTGGGCAACGG + Intergenic
1151022504 17:70633884-70633906 AAGCATTTGTGTATGGGCCTGGG + Intergenic
1151494635 17:74452153-74452175 AGGCAGGTCTTCATGGCCCAGGG - Intergenic
1152116222 17:78389162-78389184 AAGCAGTTCTGCCTCAGCCACGG + Intronic
1152536972 17:80956505-80956527 CAGGAGCTCGGCATGGGCCACGG - Intronic
1153355103 18:4125556-4125578 AGGCAGGTCTGCATGAGACATGG + Intronic
1153585616 18:6617144-6617166 AAGCACTTCAGCATGAGCAAAGG + Intergenic
1156444706 18:37227060-37227082 AAAAAGTTTTGCATGGGCCTGGG - Intronic
1157271391 18:46279034-46279056 AGGCAGTGCTGCAGGGGCCATGG + Intergenic
1159602968 18:70446175-70446197 AAGCATTTCTGCCAGGCCCAGGG + Intergenic
1163230893 19:16001470-16001492 AGGCACTTCTGCAAGGGCTAAGG - Intergenic
1163455338 19:17403175-17403197 GAGCAGGTCTGGAGGGGCCATGG - Exonic
1165271048 19:34707957-34707979 AAGCAGTTGTACCTTGGCCAAGG + Intergenic
1166512137 19:43416052-43416074 AAGCACTTCTCCATGGGCCAAGG - Intronic
1168696904 19:58408809-58408831 AGGCAGCTCTGCGTGGGCCGGGG + Exonic
1168711305 19:58501539-58501561 GAGCAGTCCTGGCTGGGCCAAGG - Intronic
925899041 2:8495447-8495469 AAGCAGCTCTTCAGTGGCCATGG - Intergenic
926359864 2:12076715-12076737 AAGGAGTTTTGCATGAGACAAGG + Intergenic
929592851 2:43158260-43158282 GAGCAGTGCTGCAGGGGGCAGGG - Intergenic
932102877 2:68916622-68916644 AAGCAGTTTTGAAAGGGACATGG - Intergenic
932319672 2:70812484-70812506 GAGCAGTTCTGCGTGTCCCAGGG - Exonic
933092235 2:78135800-78135822 AAGCAGTTCTTTAAGGGCAAAGG - Intergenic
936706062 2:115075045-115075067 AAGCAGTTATACGTGGGTCATGG + Intronic
936718625 2:115221410-115221432 AGGCTGTTCCGCATGAGCCATGG - Intronic
937590752 2:123610492-123610514 AAGCAGTCCTGCCTCGGCTAAGG + Intergenic
937915636 2:127097471-127097493 AAGCAGGCATGCATGGGACAGGG + Intronic
940869285 2:158846851-158846873 AAGCAGGTCTGCATTATCCAGGG + Intronic
942362554 2:175187646-175187668 AAGCATTTCTGCTTTGGCAATGG - Intergenic
1168820937 20:773493-773515 AAGGGGTTCTGAAGGGGCCATGG + Intergenic
1170267686 20:14486123-14486145 AAGGAGTTTTTCATGGACCAGGG + Intronic
1170786253 20:19470109-19470131 AGGCAGAGCTGAATGGGCCAAGG - Intronic
1171059135 20:21939231-21939253 AAGCAGTTCTTTATGGTCTAGGG + Intergenic
1173290692 20:41712356-41712378 TAGAAGAACTGCATGGGCCAAGG + Intergenic
1175082097 20:56429263-56429285 ACGCACTGCTGAATGGGCCAGGG - Intronic
1178037180 21:28598240-28598262 AACTAGTGCTGCATGGCCCAAGG - Intergenic
1179201158 21:39222393-39222415 AGGCAGTTTTTCAGGGGCCATGG - Intronic
1181287465 22:21764444-21764466 TGGCAGTTCTGAAGGGGCCAGGG + Intronic
1181802177 22:25354829-25354851 ATACAGGTCTGGATGGGCCAGGG + Intronic
1183268786 22:36847802-36847824 CAGCAGCACTGCATGGGCAAAGG + Intergenic
1184496774 22:44846667-44846689 AGGCAGTTCTGCCTGGGAGAGGG - Intronic
1185188186 22:49415792-49415814 AAGCAGTTCTGCATGGGCCATGG + Intronic
952232750 3:31448401-31448423 AAGCATTTCTCCAGGGCCCAAGG + Intergenic
952884005 3:38001894-38001916 GCCCAGTTCTGCATGGGCCATGG + Intronic
953701328 3:45198271-45198293 AAGCAGATGTGCTTGGGCCCAGG - Intergenic
954035931 3:47851218-47851240 AGGAAGTGCTGCCTGGGCCAGGG - Intronic
954807298 3:53228063-53228085 CAGCAGTTCGGCAGCGGCCAAGG + Exonic
955412083 3:58662168-58662190 CAGCAGGCCTGCAGGGGCCAGGG - Intronic
955985843 3:64573201-64573223 AAGGACTAATGCATGGGCCAGGG + Intronic
960799729 3:121526162-121526184 AAGGGGTTCTGGATGGCCCAAGG + Intronic
961621530 3:128228404-128228426 AGGCACATGTGCATGGGCCACGG + Intronic
962492564 3:135908514-135908536 AAGCATCTCTGCCTGGGCCGAGG - Intergenic
967046427 3:185741518-185741540 TAGCAGTTATTCATGGGACAGGG - Intronic
968865833 4:3210639-3210661 AAGAAGCCCTGCTTGGGCCATGG - Intronic
974751940 4:66153607-66153629 CAGCAGGTCTACAAGGGCCATGG + Intergenic
975936779 4:79591088-79591110 AATCAGTTCTGCCTTGCCCAAGG - Intergenic
978842840 4:113234924-113234946 AATCTGTACTGCATGGGACAAGG - Intronic
982179724 4:152738568-152738590 GAGCAGATATGCAGGGGCCAGGG + Intronic
985921951 5:2984349-2984371 GGGCTGTTCTGCATGGACCATGG + Intergenic
992253212 5:74896249-74896271 AAGCAGTAATGGATGGGGCAGGG + Intergenic
992407668 5:76475225-76475247 AAGCAGTAGTGCATCAGCCAGGG + Intronic
993810299 5:92467886-92467908 AGGCGGCTCTGCAGGGGCCAAGG + Intergenic
994729211 5:103472092-103472114 CAGCAGTCCTACATGTGCCATGG + Intergenic
996620321 5:125493545-125493567 AAGTAGATCTGCATGGCCCAAGG - Intergenic
996703414 5:126472499-126472521 AAACAGTTCTCCATGGGGTATGG + Intronic
997595662 5:135105664-135105686 ATGCAGTTGTGCTTGGGCCCAGG - Intronic
998128320 5:139638517-139638539 AAGCAGGTCAGCCTGGCCCATGG - Intergenic
999383812 5:151140326-151140348 AAGCAGCTCAGCCTGGACCAGGG - Intronic
1001256526 5:170187622-170187644 GAGAAGTTCTGGATCGGCCATGG - Intergenic
1001513018 5:172336953-172336975 AAGCAGCTCTGCCTGGCCCTTGG + Exonic
1001562123 5:172676643-172676665 CAACAGTCCTGCATGGGCCTTGG + Intronic
1001966149 5:175911196-175911218 AAGCAGCTCTGCCTTGGGCAGGG - Intergenic
1002250796 5:177928006-177928028 AAGCAGCTCTGCCTTGGGCAGGG + Intergenic
1002559850 5:180073662-180073684 AAGCCGTTCTCCATAGGCCAGGG - Intergenic
1003540561 6:7014709-7014731 CAGCACTTCTGCAAGGGCTATGG + Intergenic
1005932539 6:30494274-30494296 ATGCAGTTCTGGGTGGACCATGG - Intergenic
1007599436 6:43072605-43072627 AATCAATTCAGTATGGGCCATGG + Intronic
1012985134 6:105867470-105867492 AAGCAATTCAGTATTGGCCAGGG + Intergenic
1014484374 6:121980929-121980951 AAGCAGTTCTTCATGTCCCTTGG + Intergenic
1017738907 6:157387427-157387449 ATGCAGTTCTGCATGGCCAGGGG - Intronic
1020624211 7:10558030-10558052 AAGCAGTACACCATGGGCGATGG + Intergenic
1021944100 7:25708459-25708481 AGGCACCTCTGCATGGGCCGAGG + Intergenic
1022342816 7:29484917-29484939 CAGCAGTTATGCCTGGACCAAGG - Intronic
1025970680 7:66321446-66321468 AACCAGTACAGCATGGCCCAAGG + Intronic
1028956159 7:96694161-96694183 AAGCAGATCAGCAGCGGCCAGGG + Intronic
1032517546 7:132518419-132518441 CAGCAGTCCAGCAGGGGCCATGG + Intronic
1033327223 7:140389843-140389865 AAGCTGTTCTTCAGAGGCCAAGG + Intronic
1034856431 7:154552553-154552575 AAGCTGTGCTGGATGGTCCATGG + Intronic
1035070781 7:156143713-156143735 CAGCAGTTCTGCAAGTGCCCAGG - Intergenic
1042373646 8:68021861-68021883 AGGCTGTTCTTCATGGGCCAGGG + Intronic
1042421412 8:68594236-68594258 ATGCAGATATCCATGGGCCAAGG - Intronic
1043151308 8:76719871-76719893 AAGCAGTTCTGCATTAGAAAGGG + Intronic
1045100282 8:98837209-98837231 AAGCAGTTCTGAGAGGGCAAGGG - Intronic
1047215391 8:122872029-122872051 CAGCAGGACTGCAGGGGCCAGGG - Intronic
1047870640 8:129078042-129078064 AAGAACTTCTGCCTGGGTCATGG + Intergenic
1048209800 8:132445336-132445358 AGGCAGGTCTCCATGGCCCAGGG + Intronic
1053537449 9:38939462-38939484 AAGCATTCCTGGATTGGCCATGG + Intergenic
1054628686 9:67424468-67424490 AAGCATTCCTGGATTGGCCATGG - Intergenic
1057243901 9:93437974-93437996 AAGGAGTTCTGCATGTGTGAGGG - Intergenic
1057753014 9:97807579-97807601 AAGCAGTTCTACATGAGCCCTGG + Intergenic
1060056769 9:120420833-120420855 CAGAAGTGCAGCATGGGCCAAGG + Intronic
1061280856 9:129597155-129597177 AAGCAGTTCTGTCTGGCCAAGGG + Intergenic
1062416848 9:136455507-136455529 AAGCAGTTCTCCAGGAGGCAAGG + Intronic
1187511751 X:19925888-19925910 AAGCTGTTCTGTTTGTGCCAGGG - Intronic
1187697044 X:21933292-21933314 GCGCAGCTCTGCCTGGGCCAGGG + Intergenic
1189625799 X:42895460-42895482 AATCAGCTCTGCATGGGTTAGGG - Intergenic
1190443698 X:50501844-50501866 AAGCTGTTCTGCATGTTGCAAGG + Intergenic
1190913275 X:54790997-54791019 AAGCAGTTCCTCATAGGCCAGGG + Exonic
1200768068 Y:7097583-7097605 AAGCACTTCTGGAGAGGCCACGG - Intergenic
1200888157 Y:8292972-8292994 AAGCTGCTCAGCCTGGGCCAGGG - Intergenic