ID: 1185191274

View in Genome Browser
Species Human (GRCh38)
Location 22:49438082-49438104
Sequence GCCCGCAGGCTCCTGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185191268_1185191274 18 Left 1185191268 22:49438041-49438063 CCAGACAAGCAGCGTCTGCCAGG 0: 1
1: 0
2: 2
3: 6
4: 161
Right 1185191274 22:49438082-49438104 GCCCGCAGGCTCCTGGTCAGAGG No data
1185191271_1185191274 0 Left 1185191271 22:49438059-49438081 CCAGGCAGACAGAGGCAGCAGAC 0: 1
1: 0
2: 5
3: 61
4: 1187
Right 1185191274 22:49438082-49438104 GCCCGCAGGCTCCTGGTCAGAGG No data
1185191267_1185191274 19 Left 1185191267 22:49438040-49438062 CCCAGACAAGCAGCGTCTGCCAG 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1185191274 22:49438082-49438104 GCCCGCAGGCTCCTGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185191274 Original CRISPR GCCCGCAGGCTCCTGGTCAG AGG Intronic
No off target data available for this crispr