ID: 1185191858

View in Genome Browser
Species Human (GRCh38)
Location 22:49443147-49443169
Sequence GGTAGGGGGTGATACTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185191858_1185191866 6 Left 1185191858 22:49443147-49443169 CCTTCAAAGTATCACCCCCTACC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1185191866 22:49443176-49443198 GACAGGAATACAAAGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185191858 Original CRISPR GGTAGGGGGTGATACTTTGA AGG (reversed) Intronic
900697663 1:4022346-4022368 GGTGGGGTGTGATCCTGTGATGG - Intergenic
900822406 1:4899679-4899701 GGTAGGGGGTGATACCTGGGAGG - Intergenic
902752105 1:18523839-18523861 GAGAGGAGGTGATACTTTAATGG + Intergenic
903503740 1:23817862-23817884 AGGAGGGTGTGATACTTTGGGGG - Intronic
908901007 1:68956437-68956459 GGTAGGAGGTGATTATTTTAAGG - Intergenic
915636936 1:157194140-157194162 GGGAGGGCTTGATACTTGGAAGG + Intergenic
921817960 1:219585837-219585859 GGTTGGGGGTGAGACTTTGCTGG + Intergenic
924574516 1:245267836-245267858 GGTTGTGGGTGATATTTTTAGGG + Intronic
1074640005 10:115369266-115369288 GGGATGGGGTAATTCTTTGAAGG + Intronic
1074758588 10:116646880-116646902 GGTAGAGGGTGTTGCTTTCAGGG + Intergenic
1077476365 11:2792247-2792269 GGAAGGGGCTGCTCCTTTGAGGG + Intronic
1078093226 11:8280620-8280642 GGTAGGGGGAAGTACTTAGAAGG - Intergenic
1079922241 11:26447229-26447251 GGTGGGGGGGGGTACTTTTATGG + Intronic
1090412266 11:126517497-126517519 GGTTGGGGGGGATCCTTTGCAGG + Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1093698353 12:22189035-22189057 GGTGGGTGGTGATTGTTTGATGG + Intronic
1098289335 12:68941799-68941821 AGTTGGGGGAGCTACTTTGAAGG - Intronic
1102449568 12:113030715-113030737 GGCAGGGGATGTTTCTTTGACGG + Intergenic
1107200820 13:37714681-37714703 CATGTGGGGTGATACTTTGATGG - Intronic
1112508110 13:99987669-99987691 GGGAGAGGGAGATATTTTGATGG - Intergenic
1120255311 14:82111297-82111319 GGTTGGGGGTGATAAATTGTAGG + Intergenic
1120793615 14:88607894-88607916 GGTGGGGGATGATACTTGCAGGG - Intronic
1123010384 14:105346902-105346924 GGTAGGGGGTGATGCCGTGCGGG - Intronic
1125022717 15:35000904-35000926 GGTTGGGGCTGGTACTTAGAAGG - Intergenic
1126805701 15:52346579-52346601 GGTTGGGGCTGATGCTTTGGTGG - Intronic
1128098599 15:64978714-64978736 GAAAGGGGATGATACTTTCATGG + Intronic
1128508985 15:68302117-68302139 GGGAGGGGGTGATACAGGGAGGG + Exonic
1129889249 15:79060229-79060251 GGTGGGGAGTGATACAGTGATGG - Intronic
1136346604 16:29679842-29679864 GGTACGGGGTGAAACGGTGAAGG + Intronic
1140106427 16:71964676-71964698 TTTTGGGGGTGATATTTTGATGG - Intronic
1140610521 16:76593087-76593109 GGCAAGGAGGGATACTTTGAAGG - Intronic
1144360607 17:14488172-14488194 GGAGAGGGGAGATACTTTGAAGG + Intergenic
1144805668 17:17965318-17965340 GATAGGGGGTGAGACTGGGAAGG - Intronic
1146224368 17:31052788-31052810 GGTGGGCTGTGATACTTTGTAGG + Intergenic
1147368808 17:39977206-39977228 GGTAGGGGGTGATATATGGTTGG - Exonic
1147791839 17:43018559-43018581 GGTAAGGGGTGATAAAGTGAGGG + Intronic
1149423139 17:56530215-56530237 GGTTGGGGGTGATGCTTACAAGG - Intergenic
1156920339 18:42514824-42514846 GGGAGGGAGTGAGACTTAGAGGG + Intergenic
1164187380 19:22882198-22882220 GGTATGGGTGGATACTTTAAGGG + Intergenic
1165770337 19:38376251-38376273 GGTTGGGGGTGATAATCTGGGGG + Intronic
1166620003 19:44288679-44288701 GGTAAGAGGTGATACCTTTAGGG + Exonic
925497631 2:4469813-4469835 GGAAGAGTGTGATAATTTGAGGG + Intergenic
929936132 2:46296086-46296108 GGTTGGGGGAGATACTTTTCAGG - Intronic
931152089 2:59585668-59585690 GGTAGGGGGTTGTATTTGGATGG - Intergenic
931728442 2:65132201-65132223 GGCAGGGGGTAATTCTTTGTTGG - Intergenic
932750097 2:74366032-74366054 GGTAGGGGGTGAGAAAGTGAGGG + Intronic
934556472 2:95289454-95289476 GGTAAGGGGTGACACCTGGAGGG - Exonic
936987353 2:118324071-118324093 GGGAGGGGTTGAGACTTTGAAGG + Intergenic
938393561 2:130924237-130924259 GGTGGGAGGTGAAACTGTGAGGG - Intronic
938472091 2:131574245-131574267 GGATGATGGTGATACTTTGATGG + Intergenic
941891673 2:170588659-170588681 GGTCAGGGGTGATATTTGGAAGG - Intronic
1169948831 20:11019188-11019210 GGTAGGGGAAGATACATTTAAGG + Intergenic
1170887716 20:20355573-20355595 GGGAGGGGGTCACACTGTGAGGG + Intronic
1170887864 20:20356336-20356358 GGGAGGTGGTCATACTGTGAGGG + Intronic
1170888085 20:20357318-20357340 GGGAGGTGGTCATACTGTGAGGG + Intronic
1170888160 20:20357657-20357679 GGGAGGTGGTCATACTGTGAGGG + Intronic
1176847861 21:13890553-13890575 GGTAGGGGGTGGAACTGTGTTGG - Intergenic
1178223756 21:30690449-30690471 AGTATGGGGTGAGACTTTGGGGG - Intergenic
1182921619 22:34085342-34085364 GGCAGGGGGTGTTTCTTGGAGGG - Intergenic
1183859971 22:40662737-40662759 GGTAGGTGGCAATACTTTGCAGG + Intergenic
1185191858 22:49443147-49443169 GGTAGGGGGTGATACTTTGAAGG - Intronic
952433103 3:33245214-33245236 CTTACGGGGAGATACTTTGAGGG - Intergenic
956900542 3:73711309-73711331 GGTAAGAGGTGATAAGTTGAAGG - Intergenic
958629912 3:96671639-96671661 GGTAGGGAGGTATACTCTGAGGG + Intergenic
964850569 3:161091740-161091762 GGTAGGGTGTGGTACTATCATGG + Intronic
966954248 3:184857499-184857521 GTTAAGGGATGATACTTTCAAGG - Intronic
975735404 4:77376024-77376046 GGTAGGGAGTAGTACTGTGAAGG - Intronic
977688515 4:99876638-99876660 GGTAGGTGGTGATATCTTGCAGG + Intergenic
977988715 4:103416097-103416119 GGTACGGGGTGAAACGGTGAAGG - Intergenic
979645617 4:123064293-123064315 GATAGGGAGTGAGACGTTGAGGG + Intronic
981832159 4:149014829-149014851 GGGAGGGGGTGATAAATGGATGG - Intergenic
983495305 4:168436547-168436569 GCTAGGTGGAAATACTTTGAAGG + Intronic
986157013 5:5186209-5186231 CGTAGGTGGTGATATTTTCATGG - Exonic
990082561 5:51934867-51934889 GGTAAGGGGTGATAATTTTCAGG + Intergenic
992109683 5:73481355-73481377 GCTAGGTGGTGATACCTTGCAGG - Intergenic
993193095 5:84703553-84703575 GGTAAGGGGTGATATTTTGGGGG - Intergenic
995381979 5:111545518-111545540 AGTAGGGGATGTTACTCTGAAGG - Intergenic
996745004 5:126839964-126839986 GGTAAGGGGTGATATTGTGGGGG + Intergenic
998130635 5:139649593-139649615 TGGTGGGGGAGATACTTTGATGG - Intronic
1002127250 5:177055601-177055623 GGCAGGGGGAGATACTTTGCCGG - Intronic
1004140268 6:13011789-13011811 GTTAAGGGGTGATAGTTTGGAGG + Intronic
1008720815 6:54349167-54349189 TGTAGTTCGTGATACTTTGAGGG - Intronic
1015278544 6:131407907-131407929 GGTAAGGGGTGATATTGTGGGGG - Intergenic
1016414419 6:143818069-143818091 GGTACAGAGTGATATTTTGATGG - Intronic
1016649914 6:146451086-146451108 GGTAAGGGGTGATATTGTGGGGG + Intergenic
1018100467 6:160434125-160434147 AGTTGGTGGTGATACTTTCATGG + Intronic
1021123287 7:16821204-16821226 AAGAGAGGGTGATACTTTGAGGG + Intronic
1021202914 7:17745574-17745596 GGTAGGCAGTGACAATTTGATGG - Intergenic
1023819644 7:43973380-43973402 GGTAGGGGGAGATACAAGGAAGG - Intergenic
1024796999 7:53032445-53032467 GGTAGGGGGTGATAACTATAGGG + Intergenic
1031246639 7:119321515-119321537 TGTAAGTGGTGATACTTTGCAGG - Intergenic
1042770540 8:72375582-72375604 GGTAGTATGTGATCCTTTGAAGG - Intergenic
1044632156 8:94290469-94290491 GGTGAGGGGTGAAACTTTGCAGG - Intergenic
1047102957 8:121699584-121699606 GGTAGTTGGAGATATTTTGATGG + Intergenic
1055810446 9:80142506-80142528 GGTAAGGGGTGATATTGTGGGGG - Intergenic
1062108210 9:134767149-134767171 GGGAGGGGCTGCTACTTGGAGGG - Intronic
1062171725 9:135138514-135138536 AGTAGGGGGTGAGACCTGGAGGG - Intergenic
1187045529 X:15644943-15644965 GGAAGGGTGTGATTTTTTGAAGG + Exonic
1187795515 X:22999851-22999873 TGTAGGGGGCGAGGCTTTGATGG - Intergenic
1188763302 X:34058170-34058192 GATAGGGGGTGCTGTTTTGAGGG - Intergenic
1190262717 X:48807866-48807888 GGCAGGGGGTGAGAGTTTGAGGG + Intronic
1190736047 X:53256541-53256563 GGGAGGGGGTGGCGCTTTGAAGG - Intronic
1191576958 X:62716445-62716467 GGGAGGGGGTGAAACAGTGAAGG + Intergenic
1195095541 X:101498012-101498034 GGTAGGGGGTGTAACCTTGGGGG - Intronic
1199144883 X:144353052-144353074 GGTAGGGTGTCTTACTTAGATGG - Intergenic
1201540359 Y:15099403-15099425 GGTAAGGGGTGATATTATGGAGG + Intergenic