ID: 1185193576

View in Genome Browser
Species Human (GRCh38)
Location 22:49453982-49454004
Sequence CTGCTGGTAAAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185193568_1185193576 23 Left 1185193568 22:49453936-49453958 CCAGGACTGTCAGTCAGCAGCTG 0: 1
1: 1
2: 1
3: 18
4: 205
Right 1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG 0: 1
1: 0
2: 0
3: 27
4: 308
1185193571_1185193576 0 Left 1185193571 22:49453959-49453981 CCTTGTGAGGAGGCAGAGCTCCT 0: 1
1: 0
2: 2
3: 41
4: 360
Right 1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG 0: 1
1: 0
2: 0
3: 27
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185193576 Original CRISPR CTGCTGGTAAAGAAGGAGCA GGG Intronic
901131621 1:6965087-6965109 GTGCTGGCAAGGAAGAAGCAGGG + Intronic
901199605 1:7459141-7459163 CTGCTGGGGAGGAAGGAGCAAGG + Intronic
901308730 1:8252491-8252513 CAGCAGGTAATGAATGAGCATGG + Intergenic
901646691 1:10720722-10720744 CGGCTGGCAAAGAATGAGAAGGG + Intronic
902556090 1:17247625-17247647 CTCCTGGAAGAGCAGGAGCAAGG - Intergenic
902742153 1:18446092-18446114 GTGCTGGAACAGAAGGTGCAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905340253 1:37273131-37273153 GTGCTGGGAAAGAAGAACCAAGG - Intergenic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
907796662 1:57724742-57724764 CTGCTGGTCAAGAAAGAAGAAGG + Intronic
908222199 1:62018816-62018838 CTGCTGGTAACTAACGAGAAAGG - Intronic
908514826 1:64881782-64881804 CTGCTGTTAATGAGGGACCAAGG - Intronic
909416536 1:75412760-75412782 CTTCTGGGCAAGAAGGAACAGGG - Intronic
909941817 1:81619867-81619889 CACCTGGTAAACAAGGATCAGGG - Intronic
912383418 1:109259785-109259807 CTGCTGGTAAAAGAGGATCCTGG + Intronic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
918062866 1:181077328-181077350 CCGCAGGTGAAGAAGGACCATGG - Intergenic
919676881 1:200392799-200392821 CTACTGGTAAAGGCGGAGGAGGG - Intergenic
921031304 1:211337353-211337375 CTGCTGTTCAAGAAGACGCAAGG + Intronic
922435046 1:225596505-225596527 CTTCTGATTAAGAAGGAGGAAGG + Intronic
922544263 1:226443897-226443919 CTTCTGCTAAAGAAGCAGAAAGG - Intergenic
923260826 1:232266310-232266332 CTGCTTGGAGAGAAGGTGCAAGG + Intergenic
1064229814 10:13520281-13520303 CTGCTGGGAAGAAAGGAGCTAGG - Intronic
1064259563 10:13774309-13774331 CTGCTGGGAAAGAGAGAGGAAGG + Intronic
1065407746 10:25388607-25388629 CTGCTGGTGGAGGAGCAGCATGG + Intronic
1066177497 10:32924191-32924213 GGGCTGATAAAGAAGGTGCATGG - Intronic
1067349550 10:45463493-45463515 CTGCTGGAAGAGAAGGCGGATGG - Exonic
1067934753 10:50600240-50600262 CTGCTGGTTATGAAAGAGGAGGG + Intronic
1071265176 10:83958284-83958306 CTACTGGGAAAGAATGAGTAGGG + Intergenic
1071749555 10:88459116-88459138 TTGATGGTAAAGAGGTAGCAAGG + Intronic
1072519091 10:96214468-96214490 CTGCTGGACAAGAAGGTGCAAGG + Intronic
1072669514 10:97419124-97419146 CTGCCGGAAAAGAAAGAGGAGGG - Intronic
1072740685 10:97907345-97907367 CTGCAGGTAGAGAAGGGGGAGGG + Intronic
1073034002 10:100550473-100550495 TTGGTGGAAAGGAAGGAGCAAGG - Exonic
1073056250 10:100704653-100704675 CTGCTGGTAAAAAAGAAAAAGGG + Intergenic
1074557942 10:114509216-114509238 GTGCTGGTGAGGAAGCAGCATGG + Intronic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1075298564 10:121299800-121299822 CTGCTGGGAAGGAAGGCCCATGG + Intergenic
1075724962 10:124606405-124606427 CTGCTGGGAAAGAAAGAAAAGGG - Intronic
1075736381 10:124666945-124666967 CAGCTGGTAAAGGAGGGGCTGGG - Intronic
1076513303 10:131027482-131027504 CTGCTGGTGCAAGAGGAGCATGG + Intergenic
1077521429 11:3037674-3037696 CAGCTGGAGAAGGAGGAGCAGGG - Intronic
1077792065 11:5451698-5451720 CTGATGGGAATGAAGGAGAAAGG - Intronic
1079132805 11:17758084-17758106 CAGCTGATAAAGCAGCAGCAGGG - Intronic
1079698835 11:23518946-23518968 CTGCTGAGAGAGAAGGAGAAAGG + Intergenic
1079786536 11:24680222-24680244 CTTCTGGCAGAAAAGGAGCAAGG + Intronic
1080236604 11:30076015-30076037 ATCCTGGCAAAGAAAGAGCATGG - Intergenic
1081216334 11:40403787-40403809 CTGCTTGTAGAGAATGAGCCTGG - Intronic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1083994678 11:66266165-66266187 ATGCTGGTAAAGAAGCTGCAGGG + Exonic
1084188188 11:67486389-67486411 GTGCTGGGAAGGGAGGAGCATGG - Intronic
1084257481 11:67952901-67952923 CTGCTATTAAAGAACGAGGATGG + Intergenic
1084815288 11:71642348-71642370 CTGCTATTAAAGAACGAGGATGG - Intergenic
1087791230 11:102408195-102408217 CTGCTGGGAAGGAAGGTGCATGG - Intronic
1088081324 11:105918845-105918867 CTGATGGAAAATATGGAGCAAGG + Exonic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1089890052 11:121871749-121871771 CTGAAGGGAAAGAATGAGCAAGG + Intergenic
1090360456 11:126168863-126168885 CGGCAGGTAAAGAGAGAGCAAGG + Intergenic
1091375470 12:22257-22279 CTGCTGGGGAGGAAGAAGCAGGG + Intergenic
1091424790 12:378077-378099 CTACTGTTAAAGATGGAGAATGG - Intronic
1091801628 12:3328201-3328223 CTGCAGGTAGAGCAGGAGCTGGG - Intergenic
1092427712 12:8387690-8387712 CTGCTATTAAAGAATGAGGATGG + Intergenic
1092428982 12:8394671-8394693 CTGCTATTAAAGAATGAGGATGG + Intergenic
1096969943 12:55657619-55657641 CTGCTGCTGAGGCAGGAGCATGG - Intergenic
1096981049 12:55728499-55728521 CTGCGGGTAAAGAGGGGGCTGGG - Intronic
1097353599 12:58576644-58576666 CTGCTGGTCAACAAAAAGCATGG - Intronic
1101969701 12:109304534-109304556 CTGCTGCTGATGAAGGGGCAGGG - Intronic
1102928591 12:116845511-116845533 CAGCTGGTCAAGATGGAGAAAGG + Intronic
1103027724 12:117587392-117587414 CTGCTGGTTTTGAAGGAGGAGGG + Intronic
1103158649 12:118708696-118708718 CAGCTGGAAATGAAGCAGCAAGG - Intergenic
1104113796 12:125729349-125729371 CAGCTGATAAAGCAGGAGCAGGG + Intergenic
1104247805 12:127060410-127060432 GTGCTGGGAAAGGAAGAGCACGG + Intergenic
1105602686 13:21901421-21901443 CTGCTGGTAAGAAAACAGCAGGG + Intergenic
1105784558 13:23735544-23735566 CTGCTGGGAAGGAGAGAGCAAGG - Intronic
1106764931 13:32904037-32904059 CTGCTGGTCCAGAAGTAGGAGGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107103240 13:36616907-36616929 CAGCTGGTAAACACTGAGCATGG + Intergenic
1107318102 13:39155929-39155951 CTGCCATTAAAAAAGGAGCAAGG - Intergenic
1110822436 13:79932502-79932524 CCTCTGCTAAAGAAGGATCAAGG + Intergenic
1111456247 13:88487717-88487739 CTGCTAGCCAAGAAGGAGAAAGG - Intergenic
1112045576 13:95593627-95593649 CAGCTAGTAATGAAGGAGCCAGG - Intronic
1112127266 13:96481723-96481745 CAGCTAAAAAAGAAGGAGCAGGG + Intronic
1113066043 13:106375118-106375140 CTGCTGGAAAGGAAGAAGAATGG - Intergenic
1113506022 13:110816518-110816540 TTGCCTTTAAAGAAGGAGCAGGG - Intergenic
1114057346 14:18983390-18983412 CTGCCAGAAAAGAAAGAGCAAGG + Intronic
1114105200 14:19418357-19418379 CTGCCAGAAAAGAAAGAGCAAGG - Intronic
1115975451 14:38992012-38992034 CTGGTGGTAAAGAAGAACCAAGG - Intergenic
1116089511 14:40287035-40287057 CTCCTGTTCAAAAAGGAGCATGG + Intergenic
1116124197 14:40760329-40760351 CTCCTGGTAAAGATGGATAAAGG - Intergenic
1116409567 14:44606003-44606025 TTGCTGGTAAGGATGGAGGAAGG - Intergenic
1116989632 14:51261861-51261883 TTGCTGGTCAAGAAGGTGCAGGG + Intergenic
1120252137 14:82070744-82070766 CTGGTGGAAAAGAAGGTGCTTGG - Intergenic
1120745193 14:88145953-88145975 CTGCTGGAAATGGAAGAGCATGG + Intergenic
1120840722 14:89082857-89082879 CTGCTGGCAAACAGGGAGGAGGG - Intergenic
1122804470 14:104249671-104249693 CTGGTGGGACAGAAGGAGCTAGG + Intergenic
1123032559 14:105458767-105458789 CTGCTGGCAGGGAAGGTGCATGG - Intronic
1123695793 15:22878236-22878258 ATGCTGAAGAAGAAGGAGCAAGG + Intronic
1124609845 15:31200952-31200974 CTGCTGGGGAAGAAGGAGCCTGG + Intergenic
1125411614 15:39411925-39411947 CTGATGGTAAGGTAGGAGGAAGG + Intergenic
1126884150 15:53131385-53131407 CTGCTGAGAAAGATGGACCAAGG - Intergenic
1127693639 15:61422423-61422445 CTTCTGTTTAAGCAGGAGCAAGG - Intergenic
1129690600 15:77711145-77711167 GTGGTGGCAAAGGAGGAGCAAGG - Intronic
1131710113 15:95044576-95044598 CTGCTGTCAAGGAAGGACCATGG + Intergenic
1131723298 15:95195319-95195341 CAGTTGTTAAAGAAGGAGAAGGG + Intergenic
1133203444 16:4218632-4218654 CTGCTGGTGATGGAGGAGCAGGG - Intronic
1133370526 16:5242679-5242701 CTGCTATTAAAGAACGAGGATGG - Intergenic
1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG + Intronic
1133698839 16:8290149-8290171 ATGCTGGTAGAAAAGGAGGAGGG - Intergenic
1134127632 16:11627296-11627318 CTGCTGGCAAAGATGGTGCTGGG - Intronic
1134662273 16:15993048-15993070 CTGCTGTGAAGGAAAGAGCAGGG - Intronic
1135671857 16:24382267-24382289 CTCCTGGTGGAGAAGGAGGAGGG - Intergenic
1136783212 16:32920129-32920151 CTCATGGAAAATAAGGAGCAAGG + Intergenic
1138283890 16:55793487-55793509 CTGGTGGCAAAGACAGAGCACGG + Intergenic
1138285112 16:55803500-55803522 CTGGTGGCAAAGACAGAGCACGG - Intronic
1138536757 16:57664232-57664254 CAGCTGTGAACGAAGGAGCAAGG - Exonic
1139345316 16:66299406-66299428 AAGCTCTTAAAGAAGGAGCATGG - Intergenic
1142188277 16:88705216-88705238 CTCCTGGTACAGAGGGAGCTGGG - Intronic
1203085865 16_KI270728v1_random:1184114-1184136 CTCATGGAAAACAAGGAGCAAGG + Intergenic
1143692781 17:8584422-8584444 CTGCTTGTAAAAAAGGCCCAAGG - Intronic
1147143474 17:38472312-38472334 CTCATGGAAAACAAGGAGCAAGG + Intronic
1147861099 17:43523990-43524012 CTGCTGGTAAAATAGAAACAGGG + Exonic
1148174227 17:45550098-45550120 CTGCTGGGAGAGTAGGCGCATGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148275035 17:46295349-46295371 CTGCTGGGAGAGTAGGCGCATGG - Exonic
1148297142 17:46512928-46512950 CTGCTGGGAGAGTAGGCGCATGG - Exonic
1148361698 17:47017408-47017430 CTGCTGGGAGAGTAGGCGCATGG - Intronic
1148437011 17:47693105-47693127 CTGCAGGTAGAGAATGATCAGGG - Intergenic
1148772541 17:50075730-50075752 CTGATGGTGAGGGAGGAGCAAGG + Exonic
1149122718 17:53189657-53189679 CTGCTGGGACAGCAGCAGCATGG - Intergenic
1149783788 17:59418960-59418982 AAGCTGATAAAGAAGGAGCTAGG + Intergenic
1150405445 17:64897020-64897042 CTGCTGGGAGAGTAGGCGCATGG + Exonic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1154049029 18:10935795-10935817 CTGCTGGCGAGGCAGGAGCAGGG - Intronic
1158908424 18:62036437-62036459 CTGATGGTAAAAAAGGAGAGTGG + Intergenic
1159115042 18:64104628-64104650 TTGCTGGGAGAGAAGTAGCAAGG + Intergenic
1160249460 18:77188791-77188813 CTGCTGGTAAGAATGCAGCAGGG - Intergenic
1160710618 19:549437-549459 CGGCGGGGGAAGAAGGAGCAGGG + Intronic
1161583460 19:5092902-5092924 CTGCTGGCAAGGAGGGATCAGGG + Intronic
1163643091 19:18472957-18472979 CCCCAGGTATAGAAGGAGCAGGG + Intronic
1165832966 19:38738282-38738304 CTGCTGGTGAAAAAGGAGGATGG - Exonic
1165855874 19:38879073-38879095 CTGCTGGTTAAGAGGGGGCCAGG + Exonic
925205547 2:2002908-2002930 CAGAAGGTAAAGAAGGAGCAAGG - Intronic
925931926 2:8714887-8714909 CTACTGGTAAAGGAGGGGAAGGG + Intergenic
925994249 2:9278956-9278978 TTGCTGGTAACCAAGGAGAACGG + Intronic
926332189 2:11834850-11834872 CTGCAAATAAAAAAGGAGCAGGG + Intergenic
926492315 2:13539619-13539641 CTGTTGGACAATAAGGAGCAAGG + Intergenic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
927306560 2:21580234-21580256 CTGCTGGTGGAGAAGGGGCTAGG + Intergenic
927927288 2:27022896-27022918 CTGCAGGGAAAGGAGGAGCGGGG + Intronic
928236550 2:29546893-29546915 CCGCTGCTGAAGAAGGAGCATGG + Intronic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
929568412 2:43004983-43005005 CCGCTGGTGGAGAAGGAGCTGGG + Intergenic
930921102 2:56754751-56754773 CTGCTGGTGAGGAAGCAGCCAGG + Intergenic
931086802 2:58840995-58841017 TTGCTGGTATAGGAGGAGCCTGG + Intergenic
931934600 2:67182633-67182655 CTACTGCTAAGGAAGGAACAGGG + Intergenic
931988399 2:67764029-67764051 CTGTTGGAAGAGAAGTAGCAAGG - Intergenic
932056015 2:68445100-68445122 CTGCTGGTACAGGAGGACAATGG + Intergenic
932688738 2:73894740-73894762 TTCCTGGTAAAGAGGAAGCATGG + Intronic
934527483 2:95060484-95060506 CTGCTGGAATGGAAGGGGCAGGG + Intergenic
936500168 2:113060575-113060597 CTGCTGGAAGAGAAGCTGCACGG - Intronic
936618898 2:114074859-114074881 ATGCAGGTACAGAAGGATCAGGG + Intergenic
937113479 2:119385610-119385632 CCACTGGAAAAGAAGGAACAGGG - Intergenic
938283797 2:130090102-130090124 CTGCCAGAAAAGAAAGAGCAAGG - Intronic
938334445 2:130478666-130478688 CTGCCAGAAAAGAAAGAGCAAGG - Intronic
938355379 2:130642002-130642024 CTGCCAGAAAAGAAAGAGCAAGG + Intronic
938431810 2:131248791-131248813 CTGCCAGAAAAGAAAGAGCAAGG + Intronic
938475479 2:131607380-131607402 CTGCCAGAAAAGAAAGAGCAAGG + Intergenic
939344593 2:140947473-140947495 CTGCTGTGGAAGAAAGAGCAGGG - Intronic
941059098 2:160826076-160826098 CTGCAGCTAAAGAAGCTGCATGG - Intergenic
941660621 2:168192225-168192247 CAGCAGGCAAAGAAGGAACATGG + Intronic
941929551 2:170926337-170926359 CTGCTGCTAAAGAAATAACATGG + Intergenic
942145635 2:173023768-173023790 CTCAAGGAAAAGAAGGAGCAAGG + Intronic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
944606032 2:201352147-201352169 CTGCTGGAAAGGAAGGAGCTTGG - Intronic
945093963 2:206201886-206201908 ATCCTGGAAAAGAAAGAGCAGGG + Intronic
946762419 2:223007734-223007756 CTGCTCGTAAGGAAAGAGCAGGG - Intergenic
946913864 2:224495238-224495260 CTGCTGGCAAATAAGGAAAATGG + Intronic
947089541 2:226494890-226494912 CTGCTGGAAATGAAGATGCAGGG - Intergenic
948300229 2:236900558-236900580 GTGCAGGGAAAGTAGGAGCAGGG + Intergenic
948695611 2:239731775-239731797 CTGCTGGGAAGGAAGGACCCAGG + Intergenic
1172112744 20:32556879-32556901 TCGCTGGTGCAGAAGGAGCAAGG - Intronic
1172482609 20:35279820-35279842 CTGCAGGTCAGGGAGGAGCAGGG - Intronic
1173873634 20:46356760-46356782 CTGGTGGAAAAGAAGGCCCAAGG - Intronic
1174545656 20:51323191-51323213 CAGCCAGTAAGGAAGGAGCAAGG - Intergenic
1175427556 20:58878388-58878410 CAGCTGGTAATGAAACAGCAAGG + Intronic
1175541041 20:59747814-59747836 CTGCTGGAGATGATGGAGCAGGG + Exonic
1177661678 21:24091902-24091924 CTTCTGGGAAAGAAGGAACCTGG + Intergenic
1178610571 21:34075045-34075067 ATGCTGGTAAGCAAGGAGGAGGG - Intronic
1179602700 21:42490860-42490882 CTTTTGGTAAAGAAGAAGGAAGG + Intronic
1180475835 22:15705999-15706021 CTGCCAGAAAAGAAAGAGCAAGG + Intronic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1181999521 22:26908912-26908934 CTGCTTATAACAAAGGAGCATGG + Intergenic
1182354198 22:29714945-29714967 CTGCTGGGAGAGAAGGAGGAGGG + Intergenic
1182810945 22:33116185-33116207 CTGCGGGAAAAGAAGGTGGATGG - Intergenic
1182855727 22:33516169-33516191 CTGCAGGAAATGAAGGAGCGAGG + Intronic
1182963942 22:34504179-34504201 AGGCTGGTAGAGAGGGAGCAGGG + Intergenic
1183279063 22:36922570-36922592 CTGCTGGGGAAGGAGGGGCAGGG - Intronic
1183284444 22:36953342-36953364 CTGCTGGGGAAGGAGGAGAAGGG + Intergenic
1183318950 22:37153355-37153377 CTGCTGGAAAAGAAGAAGCGTGG + Intronic
1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG + Intronic
949420425 3:3859294-3859316 CTGCAGGCAGAAAAGGAGCAAGG - Intronic
949994815 3:9608315-9608337 CTGCTGGTAAAGACATAGCCAGG + Intergenic
950379489 3:12599353-12599375 CTGCTGCTATGGAGGGAGCATGG - Intronic
951294324 3:20915323-20915345 CTGTTGGTAATGAAGATGCATGG + Intergenic
951840693 3:27031023-27031045 TTGCTCGTATAAAAGGAGCATGG - Intergenic
952620787 3:35339113-35339135 GTGCAGGTAGAGAAGAAGCAAGG + Intergenic
952775418 3:37041304-37041326 ATGCTGGAAAAGAAAAAGCAAGG - Intronic
954405719 3:50344008-50344030 CAGCTGGTAATGAAGGTCCAAGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
956248880 3:67214953-67214975 CTGCTGTTAATGAAGGTTCATGG - Intergenic
957413206 3:79866991-79867013 GAGCTGAGAAAGAAGGAGCAGGG - Intergenic
960637358 3:119796568-119796590 TTTCTGCTACAGAAGGAGCAAGG - Intronic
960657484 3:120021841-120021863 CAGCTGATAAAGCAGCAGCAGGG + Intronic
961281661 3:125769387-125769409 CTGCTATTAAAGAACGAGGATGG - Intergenic
961872698 3:130000205-130000227 CTGCTATTAAAGAACGAGGATGG + Intergenic
962827007 3:139107654-139107676 CTGCTGATAGAGAAGGAGGTAGG + Intronic
962847238 3:139283447-139283469 CTGCTGGTGAAGGAGGAGTTGGG + Intronic
963857568 3:150271038-150271060 CTTCTGGTCAAGAAGAAGCCTGG - Intergenic
963859768 3:150297110-150297132 CAGCTGGCAAATAAGGAGCTCGG - Intergenic
966435976 3:179884395-179884417 CTGCTTTTGAAGATGGAGCAAGG + Intronic
966734155 3:183175718-183175740 CTCCTGGTGGAGAAGGAGAAGGG - Intergenic
966823977 3:183948068-183948090 CTGCTGCTACTGAAGGAGCATGG + Intronic
967409008 3:189148575-189148597 TGGCTGGTAAGTAAGGAGCATGG + Intronic
968340020 3:197947758-197947780 ATTCTGGCAGAGAAGGAGCAGGG - Intronic
969016009 4:4104698-4104720 CTGCTATTAAAGAACGAGGATGG + Intergenic
969737940 4:9003646-9003668 CTGCTATTAAAGAACGAGGATGG - Intergenic
969797136 4:9535200-9535222 CTGCTATTAAAGAACGAGGATGG - Intergenic
970422326 4:15916855-15916877 CCTGTGGAAAAGAAGGAGCATGG - Intergenic
971218070 4:24680487-24680509 CTGCTGAAAAAGAGGGAGAAGGG + Intergenic
974242575 4:59269316-59269338 CTGCTGGTATAGCTGCAGCATGG + Intergenic
976460235 4:85302533-85302555 CTGCTGGTAAGGAGGGTGTAGGG + Intergenic
977129685 4:93219894-93219916 CCACTGGTTCAGAAGGAGCAGGG + Intronic
977262207 4:94811318-94811340 CTGAAGGCAAAGAAAGAGCAGGG + Intronic
979037198 4:115736521-115736543 GTGATGGTAAAGAAGGGGGATGG + Intergenic
979153686 4:117354735-117354757 CTGATTGTATACAAGGAGCAGGG + Intergenic
979443854 4:120787199-120787221 CTGATGGATATGAAGGAGCAAGG + Intronic
980418161 4:132520540-132520562 CTGGTAGTATAGAAGGAGTAGGG + Intergenic
980683113 4:136189150-136189172 CGGAAGGTAAAGAAGAAGCAAGG + Intergenic
980731166 4:136825705-136825727 CTGGTGGTAAAGGCTGAGCATGG + Intergenic
981390782 4:144189232-144189254 CTGGTGGTCTAGAAGGAACAGGG - Intergenic
982415268 4:155123919-155123941 AGGCAGGTAAAGAAGGAGAAGGG - Intergenic
982586696 4:157250407-157250429 CTGGTGCTAAACATGGAGCAGGG + Intronic
983188837 4:164732819-164732841 CTGCGGGTAAAGTAGGAAGAAGG + Intergenic
983271459 4:165567224-165567246 CAGCTGGTCAAGAAGAAACATGG + Intergenic
983800641 4:171925145-171925167 CTCCTGGTAAAGGGTGAGCAGGG + Intronic
988127562 5:27061113-27061135 CTACTGGTAAAGAAACATCAAGG + Intronic
990671087 5:58130783-58130805 CTGGTGGGGATGAAGGAGCAGGG - Intergenic
993930098 5:93927366-93927388 ATGCTGGGGAAGAATGAGCAAGG - Intronic
996885151 5:128345314-128345336 CTGTTGGTGAAGAAGGACCAAGG + Intronic
997305356 5:132831797-132831819 ATGGTGTTGAAGAAGGAGCAGGG - Intergenic
998179494 5:139926563-139926585 CTGCTGAGTAAGAATGAGCAGGG + Intronic
998260932 5:140631568-140631590 CTGCGGGGATAGAAGGAGCCAGG - Intergenic
998386968 5:141762666-141762688 TTGTTGGCAAAGAAGGAGAAGGG + Intergenic
1000844175 5:166258314-166258336 CTGCAGTTAAAGGAGGAGGAAGG + Intergenic
1001884796 5:175279801-175279823 AGGCAGGTAAAGAAGGAGAAAGG - Intergenic
1002829274 6:804514-804536 CTGCGGGGGAAGGAGGAGCATGG + Intergenic
1006240068 6:32669877-32669899 TTTCTGGGAATGAAGGAGCATGG - Intergenic
1006959418 6:37913291-37913313 CAGCTGATAAAGCAGCAGCAGGG - Intronic
1007038678 6:38701744-38701766 CTGAAGGTAAAGAACAAGCAGGG + Intronic
1007164681 6:39821105-39821127 ATGCTAGAAAGGAAGGAGCAAGG - Intronic
1008147345 6:47907753-47907775 CTGCTGGCAAAGGTTGAGCAGGG + Intronic
1008264857 6:49412305-49412327 CTGCTGGCAAAGAAGTACAAAGG + Intergenic
1010365810 6:75049895-75049917 CTGCTGGTCAAGAAGCTGGAAGG - Intergenic
1011041342 6:83033112-83033134 TGGCAGGCAAAGAAGGAGCAAGG + Intronic
1011096660 6:83673727-83673749 CTGCTGGCAAAGAAGAGGGAAGG - Intronic
1011326212 6:86151828-86151850 ATGCTGGTAAAGGAAGAGCATGG - Intergenic
1011326388 6:86152955-86152977 ATGCTGGTAAAGGAAGAGCATGG - Intergenic
1012032181 6:94085586-94085608 CTGCTGGAAAAAAATGAGAAAGG - Intergenic
1012118923 6:95339617-95339639 CTGCTAGTAAACAAGGATCAAGG - Intergenic
1012501629 6:99895030-99895052 GTGTTGGTAAAGCAGGGGCAAGG - Intergenic
1013402199 6:109809627-109809649 CTGCTGGCAAATACTGAGCAAGG - Intronic
1013826858 6:114222656-114222678 CTGCTCGTGAAGGAAGAGCAAGG + Intronic
1013910869 6:115274193-115274215 CTTCTAGTAAAGATGGAACATGG + Intergenic
1016799774 6:148156821-148156843 CAGCTGGAAAAGAAGGCACAAGG + Intergenic
1018893443 6:167997605-167997627 GTGCTGGTGAGGAAGGGGCAGGG - Intronic
1019443370 7:1058611-1058633 CTGCTGGAAGAGAAGCAGGAGGG + Exonic
1020824962 7:13016138-13016160 GTGCTGGGAAGGAAAGAGCATGG + Intergenic
1021227796 7:18048855-18048877 TTGCTGGTACACAAGGGGCATGG + Intergenic
1021619330 7:22536103-22536125 CAGCTTTTAAAGAAGGAGCATGG - Intronic
1022120468 7:27303178-27303200 CTCCTGGTAAGGAAGAAACAGGG + Intergenic
1026255947 7:68711501-68711523 TAGCTGGTAAAGCAGGAACAGGG - Intergenic
1026324791 7:69299718-69299740 CTGCTGGAACAGAACAAGCAAGG - Intergenic
1028371930 7:90101487-90101509 CAGCTTTTAAAGAAGGAGCATGG + Intergenic
1029074678 7:97926341-97926363 CTGCTATTAAAGAATGAGGATGG + Intergenic
1029296657 7:99545471-99545493 CTGATGGAAAAGAGGAAGCAAGG + Intergenic
1029664833 7:101988514-101988536 CTGGAGGGAAAGGAGGAGCAGGG - Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030639702 7:111990325-111990347 CTGCTGGTTAAGAAAGACAAAGG - Intronic
1030744167 7:113145106-113145128 CTGCTGGGAAAGACACAGCAAGG + Intergenic
1030824016 7:114132795-114132817 CAGCTGGTATAGAATAAGCAAGG + Intronic
1032418382 7:131756791-131756813 CTGCTGGTAAATGAGGACAAAGG + Intergenic
1034099350 7:148437748-148437770 GTGCTGGGAAGGAAAGAGCATGG - Intergenic
1034117200 7:148593803-148593825 CTGCTGGAAAAGAAGTGACATGG + Intronic
1036785823 8:11686094-11686116 CTTCTTGTAAAGCAGGAGGAAGG - Intronic
1036829697 8:12012237-12012259 CTGCTATTAAAGAACGAGGATGG + Intergenic
1036900046 8:12663537-12663559 CTGCTATTAAAGAACGAGGATGG + Intergenic
1038339623 8:26674398-26674420 TTGCTGGTAAAGATGTAGCCAGG - Intergenic
1039493947 8:37966877-37966899 CTTCTGGGAAAGGAGGTGCAGGG - Exonic
1039811104 8:41049102-41049124 CTGTTGCTATTGAAGGAGCATGG + Intergenic
1040705923 8:50127038-50127060 CTCCTGGTAAATAAGGACAATGG + Intronic
1042610556 8:70595247-70595269 CTTCTGGAGGAGAAGGAGCAGGG - Intronic
1043248116 8:78032135-78032157 ATGCTGATCAAGAAGTAGCAGGG - Intergenic
1043743101 8:83839134-83839156 CAGCTGGCAAAACAGGAGCATGG + Intergenic
1044107860 8:88234570-88234592 CTGCAGTTAAAGAAGGGTCAAGG - Intronic
1044413369 8:91909746-91909768 CTGCTGGAAGAGGAGGAGGAAGG + Intergenic
1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG + Intergenic
1044716285 8:95102678-95102700 CTGCTGGTACTGAAGGAGCCAGG + Intronic
1044933460 8:97271849-97271871 ATGCTGGTAATGAATGAGCCAGG - Intergenic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1048614195 8:136056619-136056641 CTGAAGGAAAAGAAGGAGCCAGG - Intergenic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1051783349 9:20714559-20714581 CAGGTGGTAAAGCAGGACCATGG - Intronic
1051807241 9:21008614-21008636 CTGGTGGTTAAGAAGGAAGAAGG - Intronic
1053417054 9:37953475-37953497 CTGATGGTAATGATGGAGGAAGG + Intronic
1054743925 9:68835294-68835316 CTGCTGGTGAGGAAGGAAGACGG - Intronic
1055245448 9:74236327-74236349 CTGCTGCTACAGAATAAGCAGGG - Intergenic
1056257176 9:84811925-84811947 CTCCTGATAAAAAAGGAACAGGG - Intronic
1056480203 9:86995639-86995661 CTGCTGGTGAAGTACGAGGATGG + Intergenic
1057227959 9:93302378-93302400 CTGCAAGTAGAGGAGGAGCAGGG + Intronic
1057459308 9:95245246-95245268 CTTCTGGTCAAGAAGCATCAAGG + Intronic
1058725501 9:107799713-107799735 CTCCTGGAAAACAAGGTGCAGGG - Intergenic
1058930167 9:109710878-109710900 CTTCTGGAAAAGAAAGAGCAGGG + Intronic
1059003638 9:110377364-110377386 CAGCTGGAAAAGAAGCAGGATGG + Exonic
1060899227 9:127242965-127242987 CCGCTGGTAAGCAAGGAGGAGGG - Intronic
1062609448 9:137367416-137367438 CTGCTGGTTAAGCAGGGGCAGGG - Intronic
1189930759 X:46006717-46006739 CAGTTGATAAAGTAGGAGCAGGG - Intergenic
1194131816 X:90090800-90090822 TTTCTGGTGAAAAAGGAGCAGGG - Intergenic
1194766690 X:97849897-97849919 CTGCTGGTGAAGTAGGTGCTTGG - Intergenic
1194807256 X:98344773-98344795 GTGCTGGCAAAGGGGGAGCAGGG + Intergenic
1199697222 X:150351420-150351442 ATGGTGGTAAAGAAGGCCCAAGG + Intergenic
1199852672 X:151736716-151736738 TTCCTGGTACAGAAGGAGCAGGG + Intergenic
1199981045 X:152920687-152920709 CTGCTGGAAAGGAAGCAGAAAGG - Intronic
1200302291 X:154989143-154989165 CTTCTGGTAAAGATGGCACAGGG - Intronic
1200389038 X:155924876-155924898 CAGCTGATAAAGCAGTAGCAGGG - Intronic