ID: 1185195133

View in Genome Browser
Species Human (GRCh38)
Location 22:49464599-49464621
Sequence TAATCACTGGGGTTTAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185195133_1185195141 19 Left 1185195133 22:49464599-49464621 CCAACCCTAAACCCCAGTGATTA 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1185195141 22:49464641-49464663 ACAGTTGTGCCTTTTCCAGAAGG No data
1185195133_1185195142 20 Left 1185195133 22:49464599-49464621 CCAACCCTAAACCCCAGTGATTA 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1185195142 22:49464642-49464664 CAGTTGTGCCTTTTCCAGAAGGG 0: 1
1: 1
2: 19
3: 51
4: 279
1185195133_1185195143 25 Left 1185195133 22:49464599-49464621 CCAACCCTAAACCCCAGTGATTA 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1185195143 22:49464647-49464669 GTGCCTTTTCCAGAAGGGCATGG 0: 1
1: 0
2: 0
3: 30
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185195133 Original CRISPR TAATCACTGGGGTTTAGGGT TGG (reversed) Intronic
902267785 1:15280581-15280603 TGATCCCTGGGGTTTTGGGCCGG - Intronic
902911496 1:19601071-19601093 TAATCACTCGTGTTTAGCATAGG + Intronic
902954386 1:19915043-19915065 AAATTACTGGGGTTTGGGGCTGG + Intergenic
903064683 1:20692674-20692696 TTTTTACTGGGGTGTAGGGTTGG + Intronic
904718867 1:32491098-32491120 TAATCAGTGGAGGTTAGGGCAGG + Exonic
905093168 1:35446138-35446160 TAATCTCTGGGGCTAAGGCTTGG + Intronic
906639304 1:47432158-47432180 TATTCACTGGGGGGTGGGGTGGG + Intergenic
907319060 1:53591392-53591414 TATTCTCTGGGCTTTAGGGCCGG - Intronic
908772722 1:67610794-67610816 TAGGCACTGGGGTTGGGGGTGGG + Intergenic
914689683 1:150014450-150014472 GAATTACTAGGTTTTAGGGTAGG - Intergenic
917367023 1:174243206-174243228 CATTCACTTGGGTTTAGAGTAGG + Intronic
917793074 1:178512354-178512376 AAATCACTGGGGATCTGGGTTGG - Intergenic
920981790 1:210843497-210843519 TTATCACTAGGGTTTTGGGTTGG + Intronic
1063475112 10:6321495-6321517 CAATGGCTGGGGTTTAGGGAAGG - Intergenic
1068251570 10:54449144-54449166 TATTTAATGGGGTTAAGGGTTGG - Intronic
1069029440 10:63579821-63579843 CCATCACTAGGGATTAGGGTGGG - Intronic
1070583070 10:77738535-77738557 ACTTAACTGGGGTTTAGGGTTGG - Intergenic
1073853365 10:107646827-107646849 TAATGACTGGAGTTAAGCGTAGG + Intergenic
1074574719 10:114657813-114657835 TAATTAATGGGGGTGAGGGTGGG - Intronic
1075292819 10:121244697-121244719 TAATCACTGAATTTTAGAGTGGG + Intergenic
1076297316 10:129396574-129396596 TGGTCACTGGGGTTTCTGGTAGG + Intergenic
1076440468 10:130477699-130477721 TGGGCACTTGGGTTTAGGGTGGG - Intergenic
1077823504 11:5777730-5777752 TAAACAATAGGGTTTAGAGTTGG + Exonic
1079902283 11:26202100-26202122 TAATTAGTTAGGTTTAGGGTAGG + Intergenic
1081691616 11:45082068-45082090 GAAGCACTGGGGTTAAGTGTGGG + Intergenic
1082182551 11:49137678-49137700 TAATCCCTGGGGTTTAGAAGTGG - Intergenic
1083778600 11:64906622-64906644 TCACCACTGGGGTCCAGGGTTGG - Intronic
1085874403 11:80388456-80388478 TTCCCACTGGGGTTTAGGGGAGG + Intergenic
1096020438 12:48320047-48320069 TAATGACAGGGGTTGGGGGTGGG + Intergenic
1096033407 12:48441553-48441575 TAATGACAGGGGTTGGGGGTGGG + Intergenic
1097011022 12:55953590-55953612 AAATCTGTGGGGTTTGGGGTGGG - Intronic
1097377004 12:58854183-58854205 TTAACACTGGGGCTTAGGTTAGG + Intergenic
1097666804 12:62487427-62487449 TAACCACTACGGTTTGGGGTAGG - Intronic
1098569257 12:71970219-71970241 GACTTACTTGGGTTTAGGGTAGG + Intronic
1100285097 12:93157641-93157663 TCATCACTGGGGTGATGGGTAGG + Intergenic
1100545534 12:95598580-95598602 TCCTCAGTGGGGTTTAGGGCAGG + Intergenic
1102261901 12:111448041-111448063 TCCTCACTGGGGTTCAGAGTTGG + Exonic
1102712862 12:114943625-114943647 CAAGCTCTGGGGTTTGGGGTAGG + Intergenic
1105739964 13:23313853-23313875 TGCCCACTGGGGTTAAGGGTGGG - Intronic
1107278191 13:38701693-38701715 CAATCATTAGGGTTGAGGGTGGG - Intronic
1107294683 13:38896386-38896408 TAATCAGTGGGGGTTAGGGAAGG - Intergenic
1107889264 13:44899966-44899988 TTATCACTGGGCTTTATTGTAGG + Intergenic
1108564657 13:51683816-51683838 TAGTCTCTGGGGTTTAGTGCTGG + Intronic
1108680277 13:52774107-52774129 TAATCCCTGGTGTTGAAGGTGGG - Intergenic
1110272376 13:73605208-73605230 GAATCTCTGGGGGTGAGGGTAGG - Intergenic
1110491754 13:76118047-76118069 TAATCTCAGGGGTTCAGGCTAGG - Intergenic
1112431026 13:99350400-99350422 TAATCACAGAGGTTGGGGGTGGG - Intronic
1117188125 14:53262751-53262773 TCATCCCTGGGATTTAAGGTTGG - Intergenic
1117541181 14:56748128-56748150 TAATCACTGAGCTTTCTGGTTGG + Intergenic
1118693148 14:68359421-68359443 TAATCACTGGGGTTGGAGGAGGG + Intronic
1120795676 14:88630580-88630602 TAATCACTGAGGTCTGGGTTGGG - Intronic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1124593643 15:31076134-31076156 CAATCACTGGGGTTTAAGCAGGG + Intronic
1125281653 15:38047958-38047980 TTAACAATGGGATTTAGGGTAGG + Intergenic
1125484749 15:40104156-40104178 TAGGCACGGGGGTTTAGGGGAGG - Intronic
1126412649 15:48388024-48388046 CCATCACTGGTGTTTAGTGTTGG - Intergenic
1127380634 15:58428136-58428158 TAACTACTGGGGTTGGGGGTGGG - Intronic
1127689576 15:61381910-61381932 TAATCACTGAAATTTAGGGAGGG + Intergenic
1131301859 15:91206646-91206668 GAATGAGTGGGGTTTGGGGTGGG + Intronic
1131984517 15:98028660-98028682 TAACCTCTTGGCTTTAGGGTTGG - Intergenic
1132345529 15:101106104-101106126 TAAACACTGAAGTTTATGGTGGG + Intergenic
1134667302 16:16028166-16028188 TAATCACTGAGGGTTGAGGTAGG - Intronic
1135053824 16:19214075-19214097 TCATAACTGGGGAATAGGGTAGG - Intronic
1135149655 16:19994669-19994691 GCATCACTGGGGGTTAAGGTTGG - Intergenic
1141784067 16:86186831-86186853 CCAACACTGGGGTTTAGGGGAGG + Intergenic
1143021038 17:3917312-3917334 TGAACACAGGGGTTTGGGGTGGG + Intergenic
1144203110 17:12958919-12958941 TCAGCACTGGGGATTAGGGGAGG + Intronic
1144390918 17:14792583-14792605 TAAACACTGGAGTTTGGGGGTGG + Intergenic
1146111652 17:30095235-30095257 TAAACACTTGGATTTAGGGGAGG - Intronic
1147349901 17:39834211-39834233 GAATTACTGGGTTATAGGGTAGG + Intronic
1149644422 17:58229396-58229418 AGATCACTTGGCTTTAGGGTGGG - Intronic
1152152988 17:78614596-78614618 TAATCCCTGGGGTTTGAGGTGGG + Intergenic
1152325540 17:79633782-79633804 CACTCACTGGGGTGAAGGGTTGG - Intergenic
1154129759 18:11726850-11726872 TAAACACTGGGGTTTTGGCTAGG - Intronic
1157616349 18:48989963-48989985 TTATCGCTGGGGTTTATTGTGGG + Intergenic
1157682186 18:49615826-49615848 TAATCAATGGGGGTTGGGGGGGG + Intergenic
1158383399 18:56961032-56961054 TATTCAGTGGGGCTTAGGGTTGG + Intronic
1159113020 18:64082322-64082344 AAATCACTGGGGCTTTTGGTGGG - Intergenic
1159548802 18:69873622-69873644 TAATCACAGAGGTTTAGGAGAGG + Intronic
1160786599 19:903049-903071 TGAACACTGGGGTTGGGGGTGGG - Intronic
1161290668 19:3492011-3492033 TAATCACTGGGGCTGGGGGCAGG - Intronic
1162659443 19:12157558-12157580 TAAAAACAGGGGTCTAGGGTGGG - Intergenic
1162904275 19:13814413-13814435 TACTAACTGGGGTTTAGGCCTGG - Intronic
1164831452 19:31324570-31324592 TTACCACTGGGTTTTAGGTTTGG + Intronic
1167140650 19:47648278-47648300 CAATCCCTGGGGTTTCTGGTCGG + Intronic
1168028755 19:53663276-53663298 TATTGACTGGGCTTCAGGGTAGG + Intergenic
1168495899 19:56850518-56850540 TAATCACTGGGATGTAAGGATGG - Intergenic
928677349 2:33662570-33662592 TTAACACTGGGGTTTGGGTTAGG - Intergenic
929567650 2:42999782-42999804 AATTCACTGGGGGTTGGGGTGGG + Intergenic
929742577 2:44618988-44619010 AAATCACTGGGGATTAGGAAGGG + Intronic
931911756 2:66907082-66907104 GAATCACTGGGGGATAAGGTAGG - Intergenic
935301856 2:101699266-101699288 TTATCGCTGGGGTGGAGGGTGGG - Intronic
935617377 2:105100730-105100752 TAATCACTGGGGGTAGGGGGTGG - Intergenic
936782981 2:116055772-116055794 TTATCCCTGGGATTTAAGGTTGG - Intergenic
937899002 2:127002417-127002439 TAATCATTTGGGATTTGGGTTGG - Intergenic
938261936 2:129902867-129902889 TTGTAACTGGGGGTTAGGGTGGG + Intergenic
940985319 2:160046375-160046397 CAATGTCTGGGGTTTAGGGCGGG + Intronic
942415588 2:175755829-175755851 TTATCACTGGGACTCAGGGTAGG + Intergenic
943781301 2:191827304-191827326 TTATCACTGTGGTGTGGGGTTGG + Intergenic
944119558 2:196226326-196226348 AAATCACTGGGCTTTGGGGATGG - Intronic
944464110 2:199983061-199983083 AAATCACTGTGGAGTAGGGTGGG + Intronic
944749165 2:202690424-202690446 TAATCACTGGGATGGGGGGTGGG + Intronic
947449048 2:230188802-230188824 TAATCCCAGGGATTTAGGGATGG - Intronic
1169228035 20:3868226-3868248 ACCTAACTGGGGTTTAGGGTAGG - Exonic
1169235411 20:3926196-3926218 TAAGCACTGGGTATTTGGGTTGG + Intronic
1170829711 20:19829687-19829709 CAAGCAGTGGGGTTTAGGCTGGG + Intergenic
1171299993 20:24051830-24051852 TAATCCCTGGTGTTGAGGGTAGG - Intergenic
1172201064 20:33126317-33126339 TAATCTCTGTGGCTTAGGTTAGG - Intergenic
1172673630 20:36651719-36651741 CATTCACTGGGGTTCAGGGCAGG - Intergenic
1173529015 20:43754322-43754344 TAATCCCTGGGGTTGGAGGTGGG - Intergenic
1185195133 22:49464599-49464621 TAATCACTGGGGTTTAGGGTTGG - Intronic
951949073 3:28178605-28178627 TGATTACTGGGGATTAGGATTGG + Intergenic
953586006 3:44201704-44201726 TTATCCCTGGGGCTTAGGGGTGG + Intergenic
953753214 3:45625148-45625170 AAATCACTATGATTTAGGGTGGG - Intronic
958629543 3:96669149-96669171 TTAACACTGGGGCTTAGGTTAGG + Intergenic
959159675 3:102708144-102708166 CCATCACTGGGGTTGAGGGTTGG - Intergenic
960903166 3:122572293-122572315 TCATCACTGGGGTTAGAGGTGGG + Exonic
960943976 3:122953375-122953397 TAAGGCCTGGGGTTCAGGGTAGG - Intronic
964978071 3:162643617-162643639 TCATCACTGGGGCTTAGCCTTGG + Intergenic
965460873 3:168961456-168961478 TAATTACTGGATTTTAAGGTAGG + Intergenic
966798192 3:183736335-183736357 TAAATACAAGGGTTTAGGGTAGG + Intronic
967623807 3:191663682-191663704 TTAACACTGGGGTTTGGGTTAGG - Intergenic
969349548 4:6590609-6590631 AGATCACTGGGGTTGAGGGCAGG - Intronic
971100093 4:23456943-23456965 TTGTAACTGGGGTTTATGGTTGG - Intergenic
972735178 4:41833585-41833607 TAAGAATTGGGGTTTAGGGAAGG + Intergenic
979107860 4:116710381-116710403 TAATCACTGGCCTTTAGTGTGGG + Intergenic
984344210 4:178500944-178500966 TAATTAGTTTGGTTTAGGGTTGG - Intergenic
994926079 5:106118752-106118774 TAATCACTGGGCTCTAGATTAGG + Intergenic
995416215 5:111916376-111916398 TAGTGACTGGGGTCCAGGGTGGG - Intronic
995666725 5:114550840-114550862 TTATCCCTGGGATTTAAGGTTGG + Intergenic
996537397 5:124592894-124592916 TAATTACTAGGATTTAGGATGGG - Intergenic
1001370488 5:171195533-171195555 CAATCACTTGGGTTTAAAGTAGG - Intronic
1001455234 5:171855125-171855147 TAATCCCTGGTGGTCAGGGTTGG - Intergenic
1003261144 6:4517262-4517284 TGAACACTGGGGGTGAGGGTGGG - Intergenic
1005310878 6:24557632-24557654 TTATCCATGGGTTTTAGGGTTGG - Intronic
1005469176 6:26145004-26145026 TAAGCCCTGGGGTTTGGGGTGGG - Intergenic
1006671569 6:35732517-35732539 TTTTCACTGGAGTTTAGGGTAGG + Intergenic
1006686885 6:35842858-35842880 GAATTGCTAGGGTTTAGGGTGGG - Intronic
1012980183 6:105821225-105821247 TAATCCCTTGGGTATAGAGTAGG - Intergenic
1013022498 6:106233431-106233453 TAAACACTGGGGCTTGGGTTAGG - Intronic
1013404271 6:109829448-109829470 CAATGACTGGGGGTTAGGGGAGG - Intergenic
1017235883 6:152117224-152117246 CAATAAATGGGGTTTGGGGTTGG + Intronic
1018208786 6:161460510-161460532 TGATCACTTGGGTTTGGGGAAGG + Intronic
1019047302 6:169159012-169159034 TGACTACTGGGATTTAGGGTTGG + Intergenic
1019196669 6:170287249-170287271 TAGTGCCTGGGGTTGAGGGTGGG - Intronic
1024002324 7:45198971-45198993 TCTTCATTGGGTTTTAGGGTAGG + Intergenic
1027349334 7:77294400-77294422 TTATTCCTGGGGTTTAGGGTAGG - Intronic
1032484208 7:132271468-132271490 TAACCACTGGGGTGGAGGGAGGG - Intronic
1032558671 7:132864966-132864988 TAATGAATGGGGTCTATGGTTGG - Intronic
1033046723 7:137968817-137968839 AAATCAATGGGGTTGAAGGTGGG - Intronic
1033806832 7:144963790-144963812 TCACCACCAGGGTTTAGGGTAGG - Intergenic
1036528787 8:9561723-9561745 GAATCTCTGGGTCTTAGGGTAGG + Intronic
1050297684 9:4222447-4222469 TAAACACAGGGGGATAGGGTAGG - Intronic
1051550639 9:18325206-18325228 GAATCACTGGGTCATAGGGTAGG - Intergenic
1052492263 9:29184948-29184970 TAATCACTGTGTTTTGGGGGTGG - Intergenic
1056256304 9:84802960-84802982 CGATCACTGGGGTTTAAGTTGGG + Intronic
1056336072 9:85570454-85570476 AAATCATTAGGTTTTAGGGTAGG - Intronic
1059870758 9:118571607-118571629 GAGTTACTGGGTTTTAGGGTAGG + Intergenic
1187090248 X:16088724-16088746 AAATCCCTGGGGTGGAGGGTGGG + Intergenic
1192198480 X:69048235-69048257 TAATTTCATGGGTTTAGGGTAGG - Intergenic
1194132663 X:90100957-90100979 TAATCAATGGGCATTTGGGTTGG + Intergenic
1197890894 X:131269259-131269281 TGCTCACTGAGGTTTAGCGTGGG + Intergenic
1199870540 X:151894458-151894480 AAAGCACTGGGGTCTGGGGTCGG - Intergenic