ID: 1185196851

View in Genome Browser
Species Human (GRCh38)
Location 22:49477040-49477062
Sequence ATGAATAGATGGATGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1116
Summary {0: 1, 1: 1, 2: 21, 3: 149, 4: 944}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185196851 Original CRISPR ATGAATAGATGGATGGTAAA TGG Intronic
900081513 1:861849-861871 ATAAATAGATGGATGATGGATGG + Intergenic
900081529 1:862063-862085 ATAAATAGATGGATGATGGATGG + Intergenic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900498161 1:2985984-2986006 ATGGATGGATGGATGGTAGATGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900573359 1:3370946-3370968 ATGAATCGATGGATGGTGAATGG - Intronic
900573396 1:3371123-3371145 ATGAATCAATGGATGGTGAATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900573460 1:3371418-3371440 ATGTATGGATGGATGATGAATGG - Intronic
900869174 1:5289630-5289652 ATGGATGGATGGATGATACATGG + Intergenic
900922029 1:5678924-5678946 ATGAATGGATGGATGAGAGATGG + Intergenic
900930959 1:5737211-5737233 ATGGATGGATGGATGATAGAGGG + Intergenic
900931032 1:5737726-5737748 ATGGATAGATGGATGGATAATGG + Intergenic
901001223 1:6149714-6149736 ATGGATGGATGGATGATGAATGG + Intronic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901006548 1:6174467-6174489 ATGGATAGATGGTGGGTAGATGG + Intronic
901006562 1:6174525-6174547 ATGGATGGATGGATGGCAGATGG + Intronic
901006658 1:6174983-6175005 ATGGATGGATGGATGGCAGATGG + Intronic
901006719 1:6175276-6175298 ATGCATGGATGGATGGTGGATGG + Intronic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901006736 1:6175364-6175386 ATGCATGGATGGATGGTGGATGG + Intronic
901006808 1:6175738-6175760 ATAGATAGGTGGATGGTGAATGG + Intronic
901863596 1:12089915-12089937 ATGGATGGATGGATGGGGAAGGG - Intronic
901863697 1:12090315-12090337 ATGGATGGATGGATGGGGAAAGG - Intronic
901880243 1:12189537-12189559 ATGAATAGATGGAGGGCACCAGG - Intronic
901940632 1:12658989-12659011 ATGAATAGATGGATGGATGGGGG + Intronic
902154667 1:14475060-14475082 ATGGATAGATGAATGGTAGATGG + Intergenic
902202609 1:14845140-14845162 ATGAATGGATGGATAGTGAGTGG + Intronic
902398004 1:16142926-16142948 ATGAGTAGATGGATGGATGAGGG + Intronic
902603883 1:17558106-17558128 ATGGATGGATGGATGGACAATGG - Intronic
902721208 1:18305383-18305405 ATGGATGGATGGATGGATAATGG + Intronic
902721214 1:18305417-18305439 ATGGATAGATGGATGGATTATGG + Intronic
902721233 1:18305529-18305551 ATGAATGGATGGATGGATGATGG + Intronic
902722855 1:18315650-18315672 ATGGGTAGATGGATGGAGAATGG + Intronic
903357842 1:22758937-22758959 ATGAATGGATGGATGGATGATGG + Intronic
903369156 1:22824167-22824189 ATGAATACATGGATCATAGATGG + Intronic
904113426 1:28144381-28144403 ATGGATGGATGGATGGTTAGAGG + Intergenic
904465139 1:30703158-30703180 ATGAATTGATGGAAGGATAATGG + Intergenic
905493653 1:38365511-38365533 AAGAATGGATGGATGGTGAAGGG - Intergenic
906240923 1:44241859-44241881 ATGGACAGATGGATGGAAGAAGG - Intronic
906769766 1:48473163-48473185 ATGCATACATGAATGGCAAAAGG - Intergenic
907790129 1:57655368-57655390 ATGAATGGATGGATGGATGATGG - Intronic
907839884 1:58146818-58146840 ATGGATGGATGGATGGATAAAGG - Intronic
908391406 1:63686869-63686891 ATGGAAGGATGGATGGTGAATGG - Intergenic
908901163 1:68958147-68958169 ATGGATGGATGGATGTTGAATGG + Intergenic
908966109 1:69765607-69765629 ATAGATAGATGGATGGAAATAGG - Intronic
909581829 1:77245131-77245153 ATGTCTAGAGTGATGGTAAAGGG - Intergenic
910004408 1:82378614-82378636 AAGCATAGGTGGAAGGTAAATGG + Intergenic
910221631 1:84893994-84894016 ACGGATGGATGGATGGCAAAGGG - Intergenic
910629163 1:89338801-89338823 ATGAAAAGATGGAAGAGAAAAGG + Intergenic
911160058 1:94675073-94675095 ATGAATAATTGGATGATAAGTGG + Intergenic
911397290 1:97326472-97326494 ATGAGAAGATGGAAGGAAAAGGG + Intronic
911755220 1:101546282-101546304 ATGAATAGATGAGTTGTAAAAGG - Intergenic
911995154 1:104757923-104757945 ATAAGTAGAGGAATGGTAAAGGG - Intergenic
912723870 1:112042245-112042267 ATGAGTACAGAGATGGTAAAAGG - Intergenic
914991557 1:152503324-152503346 AAGGATAGATGGAAGGGAAAAGG - Intergenic
915116063 1:153600520-153600542 ATAAATAAATGGATGGTGGAGGG - Intergenic
915929687 1:160052295-160052317 ATGAATAGGTGGATAGAAATAGG + Intronic
916286088 1:163107404-163107426 AAGAATAGCTGAATGCTAAAAGG + Intergenic
917347792 1:174046533-174046555 ATGGATGGAAGGATTGTAAAAGG - Intergenic
917640978 1:176982915-176982937 AGGAATAGAGGGATGGAAAAGGG + Intronic
917658698 1:177155627-177155649 TTAAATACATGGATGGTAGATGG + Intronic
918662225 1:187103729-187103751 ATGAATACATGCATAATAAAAGG + Intergenic
919045855 1:192450858-192450880 ATGAAGACATTGAGGGTAAAGGG + Intergenic
919462680 1:197897175-197897197 ATGAATAGATGAATGAATAATGG - Intergenic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
919935143 1:202246117-202246139 ATGGATATATGGATGGAAAGAGG - Intronic
920402998 1:205688529-205688551 ATGACTGCATGCATGGTAAATGG - Intergenic
920730943 1:208483867-208483889 ATGGATAAATGAATGGTAAGGGG - Intergenic
921480453 1:215658965-215658987 TTGAATTCATGGATGATAAATGG - Intronic
922745570 1:228041547-228041569 ATGAATTGATGGATGGTGGATGG - Intronic
922745787 1:228042865-228042887 ATGGATAGATGGGTGGTGGATGG + Intronic
922745795 1:228042926-228042948 ATGGATGGATGGATGGTGAATGG + Intronic
922790581 1:228308776-228308798 ATGGATGGATGGATAGTGAATGG - Intronic
922790588 1:228308821-228308843 ATAAATAGATGGATTGTGGATGG - Intronic
922790883 1:228310319-228310341 ATGAATGGATGGATTATGAATGG - Intronic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922790901 1:228310424-228310446 ATGGATAGATGAATAGTAAATGG - Intronic
922790926 1:228310593-228310615 ATGGATAGATGGATAGTAAATGG - Intronic
922792817 1:228319506-228319528 ATGGATAGATGAATGGTGTATGG - Intronic
922792838 1:228319638-228319660 ATGGATAGATGAATGGTGGATGG - Intronic
922792858 1:228319739-228319761 ATGAATGGATGAATGGTGGATGG - Intronic
922792900 1:228320017-228320039 ATGGATGGATGGATGGTAGATGG - Intronic
923301440 1:232644323-232644345 ATGGATAGATGGATGGATGAAGG - Intergenic
923946220 1:238890657-238890679 ATAAATAGAGAGATGATAAATGG - Intergenic
924063175 1:240197298-240197320 ATGAAGAGATGGATGGGGAGAGG - Intronic
924429033 1:243980637-243980659 ATGAATGGATTAATGGTTAATGG + Intergenic
1062940175 10:1415011-1415033 ATGGATAGATGGATGATAGATGG + Intronic
1062940195 10:1415088-1415110 ACCAATGGATGGATGGTGAATGG + Intronic
1062940263 10:1415417-1415439 ATGAATAGATGGTGGATGAATGG + Intronic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1062943868 10:1445125-1445147 GTGAGTGAATGGATGGTAAATGG - Intronic
1063073295 10:2689016-2689038 ATGAGAAGATGGATGATGAATGG - Intergenic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1064410714 10:15101481-15101503 ATGAGTAGAAGGATGCTTAATGG - Intronic
1064418437 10:15169365-15169387 ATGGATAGATAGATGCGAAATGG - Intergenic
1064698503 10:17992207-17992229 ATGGATAGAGGGATGATAGATGG + Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065141912 10:22726167-22726189 ATGAATACTTGGATGGTCAGTGG - Intergenic
1065710530 10:28512814-28512836 ATGCATATATGTATGGTAACAGG + Intergenic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1065860704 10:29870447-29870469 ATGAATGGATAGATGGGAGATGG - Intergenic
1065860728 10:29870550-29870572 ATGAATGAGTGGATGGTAGATGG - Intergenic
1065860736 10:29870603-29870625 ATGAATGGATCGATGGTAGATGG - Intergenic
1065860770 10:29870778-29870800 ATGAATGGATGGATGGTAAATGG - Intergenic
1065860789 10:29870885-29870907 ATGAATGGATGGATGGTAGATGG - Intergenic
1065860810 10:29871009-29871031 ATAAATGGATGGATGGTAGATGG - Intergenic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1066517522 10:36179683-36179705 ATGGATAGAGGGATGGATAATGG + Intergenic
1066623712 10:37384600-37384622 ATGAAAAGACCGATGGTGAAAGG + Intergenic
1067709629 10:48637607-48637629 GTGAATGGATGGATGGCAAATGG + Intronic
1067751644 10:48975691-48975713 ATGAGTAGATGGAGTGTGAATGG + Intronic
1071131212 10:82395660-82395682 ATGAATGGATGGATGATGGATGG - Intronic
1071131215 10:82395675-82395697 ATGAGTGGATGGATGATGAATGG - Intronic
1071509032 10:86249872-86249894 ATAAATGGATGGATGGTGGAAGG + Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467176 10:103700990-103701012 ATAGATGGATAGATGGTAAATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467198 10:103701100-103701122 ATGGATGGCTGGATGGTAGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467222 10:103701217-103701239 ATGGATGGCTGGATGGTAGATGG - Intronic
1073467235 10:103701288-103701310 ATGAATGGATGGATGATGGATGG - Intronic
1073467239 10:103701311-103701333 ATGAATGGATGGATGATGGATGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467274 10:103701484-103701506 ATGAATGGATGGATGATGGATGG - Intronic
1073467342 10:103701856-103701878 ATAGATGGATAGATGGTAAATGG - Intronic
1073467344 10:103701871-103701893 ATGGATGGATGGATGATAGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467376 10:103702031-103702053 ATGGATAGATGGATGATGGATGG - Intronic
1073467381 10:103702057-103702079 ATGGATAGATGGATGGATGATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1073729110 10:106269513-106269535 ATAAAAAGATGGAAGGAAAAAGG + Intergenic
1073765650 10:106679829-106679851 GTGCATGGATGTATGGTAAATGG - Intronic
1074643721 10:115419550-115419572 ATGCATAGATTGAAAGTAAATGG + Intronic
1074905385 10:117858225-117858247 ATGGATGGATGGATGGATAATGG - Intergenic
1075918305 10:126188817-126188839 ATTGATGGATGGATGATAAATGG - Intronic
1075918320 10:126188945-126188967 GTGAATAGATGGATGATGAATGG - Intronic
1075918324 10:126188979-126189001 ATGGATGGATGGATGGTGAATGG - Intronic
1076577901 10:131483168-131483190 ATGAATGGATGGATGAAAAGAGG + Intergenic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076845004 10:133065654-133065676 ATGGATAGATGGAGGGTGGATGG + Intergenic
1076845018 10:133065705-133065727 ATGGGTGGATGGATGGTGAATGG + Intergenic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1078298217 11:10097710-10097732 ATAAATAGATGCATTGAAAAGGG + Intronic
1078639960 11:13085249-13085271 AGGAATTGTTGGATGGGAAACGG - Intergenic
1078914325 11:15764250-15764272 ATGAATAGATATATGTAAAAAGG + Intergenic
1079251278 11:18790054-18790076 AAGCATAGACGGATGGTGAAGGG - Intronic
1079280693 11:19084377-19084399 ATGGATGGATGGATGATGAATGG - Intergenic
1079604622 11:22349439-22349461 ATGAATAGATGGATTGAGGAGGG + Intronic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1080538168 11:33242711-33242733 ATTAATAGATGCATGGATAAAGG + Intergenic
1080754697 11:35185581-35185603 ATGGATAGATGGATGGAGAGAGG - Intronic
1080849334 11:36054767-36054789 ATGGATAGATGGATGGATGATGG + Intronic
1081765813 11:45609394-45609416 ATGGATGGATGGATAGGAAAAGG + Intergenic
1081765852 11:45609654-45609676 ATGAATTCATGGATGATGAATGG + Intergenic
1082209344 11:49479199-49479221 CTGAATAGAAGTATGGGAAATGG - Intergenic
1082747461 11:56980620-56980642 ATTAATAGATGGATGGGGATGGG + Intergenic
1084303201 11:68264661-68264683 ATGAACAGATGGATAGGATATGG - Intronic
1084464707 11:69315475-69315497 ATGGATGGATGGATGGATAATGG + Intronic
1084491756 11:69482524-69482546 ATGAATGGATGGATGATGAGTGG + Intergenic
1084543902 11:69804227-69804249 ATGGATAGATGGATGATGGATGG + Intergenic
1084545957 11:69815199-69815221 ATGGATAGGTGGATGGTGGATGG + Intronic
1084596263 11:70118745-70118767 ATGGACAGATGGATGGTTGATGG + Intronic
1084596493 11:70119799-70119821 GTGAATAGATGGATGCCAGAGGG + Intronic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609812 11:70194913-70194935 ATGTGTGGATGGATGGTAGATGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084658780 11:70535181-70535203 GTGAGCAGATGGATGGAAAATGG - Intronic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085487232 11:76875564-76875586 ATGAACTGATGGATGGAGAAAGG - Intronic
1085795857 11:79539005-79539027 ATGAAGAGATCAATGGGAAATGG - Intergenic
1086401989 11:86468392-86468414 ATGGATGGATGGATGATGAATGG - Intronic
1086791306 11:91041739-91041761 ATGATTAGTTGGATGGTAGAGGG + Intergenic
1087659696 11:100972532-100972554 ATGGATGGATGGATGGAAAGAGG + Intronic
1088114855 11:106302526-106302548 AAGAATAGATGGATGATTTAAGG - Intergenic
1088375027 11:109131623-109131645 ATGGATGAATGGATGGTTAAAGG + Intergenic
1088375029 11:109131688-109131710 ATGGATGGATGGATGGTTAAGGG - Intergenic
1088498609 11:110458942-110458964 ATGGATGGATGGATGATACATGG + Intronic
1088600119 11:111466615-111466637 ATGGATGGATGGATGATAGATGG + Intergenic
1088713843 11:112531644-112531666 ATAAATAGCTTGAGGGTAAAGGG + Intergenic
1089166396 11:116480576-116480598 ATGTATAGATGGATGGATGAAGG + Intergenic
1089419840 11:118323272-118323294 ATGAAAGGATGGATGATAAATGG + Intergenic
1089580055 11:119476096-119476118 ATGAATAGATGGATGGTGGGTGG + Intergenic
1089580074 11:119476197-119476219 ATGAATAGATGGATGAATGATGG + Intergenic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1090157086 11:124450230-124450252 ATACATAGATGGAAAGTAAAGGG + Intergenic
1090511390 11:127379159-127379181 ATAAATAGATAGATGATAGATGG - Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1090910294 11:131112314-131112336 GTGAATTGATGGATGAAAAAGGG - Intergenic
1090995114 11:131859067-131859089 ATGGATGGATGGATGTTGAAGGG - Intronic
1091036642 11:132239983-132240005 ATGAATGGATGGATGGATGATGG - Intronic
1091654676 12:2337001-2337023 ATGGATGGATGGATGGTGAATGG - Intronic
1092038552 12:5363045-5363067 ATGAATAAATGAAGAGTAAATGG + Intergenic
1093926970 12:24918315-24918337 ATGAATGGATGCAAGGTAACCGG + Intronic
1094178903 12:27569976-27569998 ATTATTAGAGGGATGGTAAATGG - Intronic
1095525510 12:43120177-43120199 ATGAATAGATGAATGAGTAATGG - Intergenic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1096611228 12:52803316-52803338 ATGAATAGATGGATGATGGATGG + Intergenic
1096932923 12:55235640-55235662 ATGGATAGATGGAAAGTGAAAGG + Intergenic
1097285094 12:57870987-57871009 AGGAAGATAGGGATGGTAAATGG + Intergenic
1097532430 12:60821234-60821256 ATGAATGGATGGATGATAGATGG + Intergenic
1098624736 12:72650137-72650159 ATCAACAGATGGATGGATAAAGG + Intronic
1098867680 12:75781346-75781368 ATGAAAAGATGGAGGGGGAAGGG + Intergenic
1100159180 12:91837791-91837813 ATTGACAGATGGATGATAAAGGG - Intergenic
1100194946 12:92235043-92235065 AGGAACAGATGGATCCTAAATGG - Intergenic
1100469906 12:94881339-94881361 TTGAATTAATGGATAGTAAAAGG + Intergenic
1100865421 12:98852270-98852292 ATGAATAAATGAATGGCAATGGG + Intronic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101259473 12:103013639-103013661 AAGAATGGATGGATGGAAACTGG + Intergenic
1101639838 12:106579970-106579992 ATGAATACATTAATAGTAAATGG + Intronic
1101822310 12:108193527-108193549 ATGAATAGATTAATGGTAGGTGG + Intronic
1102041329 12:109802807-109802829 ATGGATAGATGGATGGATGAAGG - Intronic
1102043146 12:109813689-109813711 ATGAATAGATGGATGGATGATGG + Intronic
1102043168 12:109813845-109813867 ATGAATGGATGGATGGATGATGG + Intronic
1102043192 12:109814041-109814063 ATGTATGGATGGATGATATATGG + Intronic
1102444560 12:112991945-112991967 ATAAATGGATGGAAGGTAAATGG + Intronic
1102506931 12:113389617-113389639 GTGAGTGGATGGATGATAAATGG - Exonic
1102507108 12:113390567-113390589 GTGGGTAGATGGATGATAAATGG - Exonic
1102507133 12:113390703-113390725 GTGGGTAGATGGATGATAAATGG - Exonic
1102507159 12:113390834-113390856 ATGGGTAGATGGGTGATAAATGG - Exonic
1102557045 12:113733741-113733763 ATGAATGGATGGATGAAAACTGG - Intergenic
1102785952 12:115604959-115604981 AAGAATAGATGGATGGACAATGG + Intergenic
1103002471 12:117395863-117395885 ATGAATGGATGGCTGGATAATGG - Intronic
1103012833 12:117470409-117470431 AAGGATGGATGGATGGTAAACGG - Intronic
1103017775 12:117508943-117508965 ATGAGTGGATGGATGGTAGGTGG + Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103064171 12:117883084-117883106 CTGAATGGATGGATGGTTGAAGG - Intronic
1103163183 12:118747979-118748001 ATGGATGGATGGATGGCAGAAGG - Intergenic
1103190327 12:118995798-118995820 ATGAGTAAATGCATGATAAACGG - Intronic
1103211730 12:119172067-119172089 ATCAATAAACGGATTGTAAAAGG - Intergenic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103403915 12:120661386-120661408 ATGAATAGATGCATGGGGAAGGG - Intronic
1103530449 12:121597564-121597586 ATGAATAGATGGACGTAAAATGG + Intergenic
1103992527 12:124808637-124808659 ATGAATGGATGGAGGGTGGATGG - Intronic
1104034688 12:125090140-125090162 ATGGATAGATGGATGGATGATGG - Intronic
1104075695 12:125387792-125387814 ATGGATGGATGGATGGATAACGG - Intronic
1104475266 12:129065917-129065939 ATGAATAGATGAATGGTGGGTGG - Intergenic
1104491563 12:129198421-129198443 ATCAACAGATGGATGGGTAAAGG + Intronic
1104778440 12:131404766-131404788 ATGAATGGATGGATGATAAATGG - Intergenic
1104803159 12:131568547-131568569 ATGAATGGATGGATGGATAGGGG - Intergenic
1105524094 13:21158935-21158957 AGGAGTAGATGAATTGTAAATGG + Intronic
1105966718 13:25391320-25391342 ATGAATAGATGGGTGAAGAATGG - Intronic
1106232916 13:27835462-27835484 ATGGATGGATGGATGATAGATGG + Intergenic
1106569612 13:30915334-30915356 CTGAATAGATGGATGGCAAGAGG + Intronic
1106586309 13:31059184-31059206 ATGAAAAGATGGAGGATGAATGG + Intergenic
1106722920 13:32454688-32454710 ATAAATAGATGGAAGTTAGAAGG + Intronic
1106802905 13:33274770-33274792 TTGAAAAGATGGCTGTTAAACGG + Intronic
1107292503 13:38871696-38871718 ATGGATAGTTGGATGGTCAATGG - Intronic
1107416160 13:40202592-40202614 AGGCAGAGATGGATGGGAAAGGG + Intergenic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1108023950 13:46159056-46159078 AAGACTAGATGGAAGGTGAAGGG + Intronic
1108698935 13:52927271-52927293 ATGAATGGAAGGAGGGAAAAAGG - Intergenic
1108739871 13:53325478-53325500 ATGAATGGATTGATTTTAAATGG - Intergenic
1109638369 13:65153227-65153249 ATAAATAAAAGGATGGAAAAAGG - Intergenic
1109768015 13:66930604-66930626 ATTAATAGATGAATGGCAACAGG - Intronic
1112727064 13:102317019-102317041 ATGAATTAATGAATGGAAAATGG - Intronic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113628076 13:111861193-111861215 ATGGATATTTGGAAGGTAAATGG + Intergenic
1113628082 13:111861235-111861257 ATGGATATTTGGAAGGTAAATGG + Intergenic
1113684811 13:112275647-112275669 ATAGATAGATAGATGGAAAAAGG + Intergenic
1113901007 13:113798081-113798103 ATGGATAGAAGGATGGATAATGG + Intronic
1113901059 13:113798357-113798379 ATGAATAGAAGGATGGATAATGG + Intronic
1113901073 13:113798443-113798465 ATGAATCGAAGGATGGATAATGG + Intronic
1113901113 13:113798649-113798671 ATGAATGGAAGGATGGATAATGG + Intronic
1115349176 14:32374783-32374805 ATGAATTGATGGATTATAAAGGG - Intronic
1115483378 14:33884721-33884743 ATTAGTAGGTGGTTGGTAAAAGG - Intergenic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1116427204 14:44805946-44805968 ATTGATAGATGAATGGTTAAAGG - Intergenic
1116890506 14:50263594-50263616 ATGGAGGGATGGATTGTAAATGG + Intronic
1117016636 14:51525172-51525194 ATGGATGGATGGATGGATAAAGG + Intronic
1117868633 14:60174992-60175014 ATGAATAGATGGAGGAGAAAAGG - Intergenic
1117900706 14:60529580-60529602 ATGAATGGATGGATGATTATAGG - Intergenic
1117965404 14:61202477-61202499 ATATATAGATGCATGGAAAATGG + Intronic
1118049261 14:62008849-62008871 ATCAATTGAAGGATGGAAAATGG - Intronic
1118090106 14:62465270-62465292 ATGGCTGGATGGATGGTACACGG - Intergenic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1120568519 14:86089374-86089396 TTGAGTAGATTGATGGGAAAAGG + Intergenic
1121005019 14:90484562-90484584 ATGGATAGATGGATGGCAGATGG - Intergenic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121499772 14:94425466-94425488 ATCAGTAGATGGAGGGTGAAGGG + Intergenic
1121816009 14:96929097-96929119 ATGGATAGGTGGATGGAAAGGGG - Intronic
1122600813 14:102920828-102920850 GTGAATAGGTGGATGGTGGATGG - Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1122910343 14:104824792-104824814 ATGTATGGTTGGATGGTGAATGG + Intergenic
1125431837 15:39603211-39603233 ATGAATGAATGGATGGCAGATGG + Intronic
1126125230 15:45289535-45289557 GAGAATATAGGGATGGTAAAAGG - Intergenic
1126260672 15:46686452-46686474 ATGGATGGATGGTTGATAAAGGG - Intergenic
1126419553 15:48457066-48457088 TAGAATAGAGGGATGGTCAAGGG + Intronic
1126748841 15:51854967-51854989 ATGAAAAGGAAGATGGTAAATGG + Intronic
1126759613 15:51957431-51957453 ATGAGTAGATGGGTGGTGGAGGG + Intronic
1128441821 15:67717101-67717123 AAGAAGAGATGAATGGTAAATGG + Intronic
1128518929 15:68362633-68362655 ATGTATAGATGGATGATGAATGG + Intronic
1128518934 15:68362660-68362682 ATGGATAAATGGATGGAAGATGG + Intronic
1128793500 15:70449467-70449489 ATGAATAGATGGAAGGATATAGG + Intergenic
1130163110 15:81422279-81422301 ATGAAAAGATGGTTGCTGAAGGG - Intergenic
1130306864 15:82718038-82718060 ATAAATAGATTGACAGTAAATGG - Intergenic
1130353625 15:83111358-83111380 GTGAATAGATGGATGGATGATGG - Intronic
1130353634 15:83111400-83111422 ATGAATGGATGGATGGATGATGG - Intronic
1130353648 15:83111488-83111510 ATGGATAGATGGATGGATGATGG - Intronic
1131044525 15:89302935-89302957 ATCAAGAGATTTATGGTAAATGG + Intronic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132030935 15:98438084-98438106 ATGGATAGATGGATGATGAATGG + Exonic
1132054495 15:98639079-98639101 ATGAGTAAATGGATGGCAGATGG + Intergenic
1132653755 16:1033021-1033043 ATGAGTGGATGGATGATAGATGG - Intergenic
1132653776 16:1033142-1033164 ATGGATTGATGGATGGTGGATGG - Intergenic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133611046 16:7433687-7433709 ATGGACAGAAGGATGGTAGAAGG - Intronic
1134072307 16:11268201-11268223 ATGAATGGGTGGATGACAAATGG - Intronic
1134075107 16:11285266-11285288 ATGAATAAGTGAATGGCAAATGG + Intronic
1134105979 16:11486287-11486309 ATGGATGGATGAATGGTACATGG + Intronic
1134106004 16:11486436-11486458 ATGGATGGATGAATGGTACATGG + Intronic
1134488469 16:14677907-14677929 ATGAATGGATGGATGATGGATGG + Intronic
1134685937 16:16158366-16158388 ATGAATGGATGGATGGGATTGGG - Intronic
1134766868 16:16766932-16766954 ATGAATGGATGGATGACAAATGG - Intergenic
1135081918 16:19443766-19443788 TTGGATGGATGGATGGTAAATGG + Intronic
1135888060 16:26331053-26331075 AAGAATAGATGAATGATAAATGG + Intergenic
1135949851 16:26903793-26903815 ATGGATGGATGGATGGCATATGG + Intergenic
1136010122 16:27358214-27358236 AGGGAAAGATGGATGATAAATGG - Intronic
1136071332 16:27789281-27789303 ATGGATGGATGGATGGTTGATGG + Exonic
1136071345 16:27789349-27789371 ATGGATGGATGGATGGTTGATGG + Exonic
1136071446 16:27790037-27790059 ATGAGTGGATGGATGGCAAATGG + Exonic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1136290811 16:29270303-29270325 ATGGATGGATGGATGGATAAAGG + Intergenic
1136482031 16:30548060-30548082 ATGGAGAGATGGATGGTCAAGGG + Intronic
1137386085 16:48043911-48043933 GTGAATGGATTGATGGTGAATGG - Intergenic
1137386087 16:48043926-48043948 ATTGATGGATGGATGGTGAATGG - Intergenic
1137386105 16:48044027-48044049 ATGGATGGATGGGTGGTGAATGG - Intergenic
1137386128 16:48044120-48044142 GTGGATGGATGGATGGTGAATGG - Intergenic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1137386142 16:48044181-48044203 ATGAATGGATGGATGGATGATGG - Intergenic
1137386145 16:48044196-48044218 ATGGATGGATGGATGATGAATGG - Intergenic
1137386148 16:48044215-48044237 ATGGATGGATGGATGATGAATGG - Intergenic
1137386153 16:48044242-48044264 ATAGATGGATGGATGGTGAATGG - Intergenic
1137386171 16:48044346-48044368 ATGAATGGATGGTGGATAAATGG - Intergenic
1137386176 16:48044391-48044413 TTGGATGGATGGATGGTAAATGG - Intergenic
1137386184 16:48044436-48044458 ATGAATGGATGGTGGATAAATGG - Intergenic
1137386189 16:48044481-48044503 ATGGATGGATGGATGGTAAATGG - Intergenic
1137569431 16:49555682-49555704 ATGGACAGGTGGATGGTAGATGG + Intronic
1137765029 16:50971481-50971503 ATGGATGGATGGATGATAGATGG - Intergenic
1137765037 16:50971519-50971541 ATGGATAGATGGGTGATGAACGG - Intergenic
1137936929 16:52643840-52643862 ATGACTAGATGGTTTTTAAAAGG - Intergenic
1138244035 16:55453097-55453119 ATGGATGGATGGATGGATAAAGG - Intronic
1138465643 16:57187479-57187501 AAGAACAGATGGTAGGTAAAGGG - Intronic
1138495703 16:57407958-57407980 ATAGATGGATGGATGGTAGATGG - Intronic
1138576940 16:57914043-57914065 ATGAACACATGGATGATAACTGG - Intronic
1139219595 16:65167019-65167041 ATGAATTGATGGATGGACAGAGG - Intergenic
1139247254 16:65457151-65457173 ATGAATAGATGGATAGATAAAGG - Intergenic
1139560598 16:67739265-67739287 ATGAAGTAATGGATGGAAAAGGG - Intronic
1140017606 16:71203149-71203171 ATGCATAGATGGATGGAAGGAGG + Intronic
1140663570 16:77210136-77210158 ATGAAGAGATGGATGGATACAGG - Intronic
1140951728 16:79824971-79824993 ATGAATGCATGGATGGTAGATGG - Intergenic
1141031873 16:80596280-80596302 ATGAATGGAAGGATGATATATGG + Intergenic
1141045985 16:80716501-80716523 AGGGATGGATGGATGATAAATGG + Intronic
1141045999 16:80716629-80716651 ATGGATGGATGGATGATACATGG + Intronic
1141110045 16:81265045-81265067 ATGGATGGATGGATGGTAGATGG - Intronic
1141110087 16:81265258-81265280 ATGAATGGATGGATGGTGAGTGG - Intronic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141110239 16:81265875-81265897 GTGGATGGATGGATGGTAGATGG - Intronic
1141208887 16:81957837-81957859 ATTCATAGCTGGATGGTATAGGG - Intronic
1141391324 16:83667074-83667096 ATGGATAGATGGATGATGGATGG + Intronic
1141421565 16:83921153-83921175 ACGAATAGATGGAAGGAAGATGG + Exonic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141483897 16:84326046-84326068 ATGGATAGATGGATGGATAGTGG - Intronic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141619874 16:85231476-85231498 ATGAATAGATGGATGGACGGAGG + Intergenic
1141650012 16:85387932-85387954 ATGGATGGATGGATGGATAAAGG + Intergenic
1141657973 16:85426207-85426229 ATGGATGGATGGATGGTAGATGG + Intergenic
1141658094 16:85426714-85426736 ATGGATGGATGGATGGTAGATGG + Intergenic
1141748849 16:85944957-85944979 ATGGATGGATGGATGATGAATGG - Intergenic
1142124131 16:88401794-88401816 GTGGATGGATGGATGGTAGATGG + Intergenic
1142124194 16:88402064-88402086 ATGGATGGATAGATGGTAGATGG + Intergenic
1142152397 16:88518440-88518462 ATGGATAGATGGATGGTGGGTGG + Intronic
1142152629 16:88519433-88519455 ATGGATAGATGCATGGTGGATGG + Intronic
1203142273 16_KI270728v1_random:1775896-1775918 ATGAATGGATGAATGGATAAAGG - Intergenic
1143152311 17:4815243-4815265 ATGGATGGATGGATGATGAAGGG + Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143408261 17:6692309-6692331 ATGAATAGATGCATGGATGATGG + Intronic
1143737741 17:8925104-8925126 ATGGATAGATAGATAGTAGATGG + Intronic
1143737747 17:8925223-8925245 ATGGATAGATAGATAGTAGATGG + Intronic
1143863847 17:9909907-9909929 ATGAATAGATGGATGGGACCGGG + Intergenic
1144047403 17:11466325-11466347 AGGAATACAAGGATGATAAACGG + Intronic
1144482846 17:15641754-15641776 ATGAATGGATGGATGGATGATGG + Intronic
1144915840 17:18723277-18723299 ATGAATGGATGGATGGATGATGG - Intronic
1145262410 17:21362340-21362362 ATGAATGGATGGATGGATGATGG + Intergenic
1145358539 17:22187710-22187732 ATCAATAGATGAATGGACAAAGG - Intergenic
1146504819 17:33395577-33395599 ATGGACAGATGGATGGTGATAGG - Intronic
1146644380 17:34567379-34567401 ATGCATAGATGGAGGGTCAGTGG + Intergenic
1146826726 17:36029582-36029604 ATGGATGGATGGATGGGAGATGG - Intergenic
1146939192 17:36832292-36832314 ATGGACAGATGGATGGTGGATGG - Intergenic
1147977502 17:44256179-44256201 ATGAATAGATGGATAATGGATGG - Intronic
1148085487 17:44991290-44991312 ATGGACAGATGGATGGGAGATGG + Intergenic
1148907800 17:50922271-50922293 AGGAATGGTTGGATGGTGAATGG + Intergenic
1149252766 17:54789079-54789101 ATGAACAGATGGATGAAAGAAGG + Intergenic
1150302462 17:64057762-64057784 AGAAATAGGTGGATGGCAAAGGG + Intronic
1150392281 17:64796911-64796933 ATAGATAGATGGATGGTGGATGG - Intergenic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1152301818 17:79499276-79499298 ATGAATAAATGGATGGTAGATGG - Intronic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152314102 17:79570155-79570177 GATAATAGATGGATGGTAGATGG + Intergenic
1152473668 17:80503934-80503956 ATGAATAGATGGGTGGATAAGGG + Intergenic
1152766974 17:82147090-82147112 ATGGATATATGGATGGTAGGTGG + Intronic
1152767267 17:82148250-82148272 ATGGATGGATGGATGGTAGATGG + Intronic
1152767482 17:82148995-82149017 ATGAATGGATGGGTGGTGGATGG + Intronic
1153274980 18:3359601-3359623 ATGAATAGATGATAGGTAGATGG + Intergenic
1153350879 18:4079961-4079983 ATGATTAGATAGATGTTATATGG + Intronic
1153857012 18:9159737-9159759 ATTAATAAATGGATGGTGAAGGG - Intronic
1155049282 18:22132375-22132397 CTGAAGAGATTGATGGTACAGGG + Intergenic
1155970532 18:32078975-32078997 AGCAATAGATGTATGGTCAAGGG - Intergenic
1156135171 18:34028986-34029008 CTCAATAGAAGGATGGAAAAAGG - Intronic
1156471604 18:37380535-37380557 ATGGATAGATGGATGGAGAATGG - Intronic
1156946067 18:42833111-42833133 ATGAATAAATGTATGTTAATAGG - Intronic
1157113141 18:44839803-44839825 ATGAATAGATGGACAGATAAAGG + Intronic
1157343745 18:46804543-46804565 ATGCATAGATAGATCGTGAAGGG - Intergenic
1157492442 18:48133800-48133822 ATGAATAGAGGGAGGGGAATCGG - Intronic
1157651804 18:49340520-49340542 ATGAATGGATGAATACTAAATGG + Intronic
1158665538 18:59429390-59429412 ATGAATAGATGCAGGGTTACAGG - Intergenic
1158753828 18:60298752-60298774 AAGAATAGAGAGATGGGAAAAGG + Intergenic
1158779303 18:60627415-60627437 AAAGATAGATGGATGGTCAATGG + Intergenic
1159058805 18:63493226-63493248 ATGAACAGCTGGAAGGTAAGTGG + Intronic
1159210448 18:65314503-65314525 ATGAAAAGATGAATGGATAAAGG + Intergenic
1159788452 18:72744542-72744564 ATGAATCCATGGAGGGAAAAGGG + Intronic
1160297415 18:77650693-77650715 ATGGATAAATGGGTGATAAATGG - Intergenic
1160502502 18:79409198-79409220 ATGAATGGATGGATAGGGAATGG - Intronic
1160502560 18:79409521-79409543 ATGAATGGATGGATGATGGATGG - Intronic
1160526684 18:79542682-79542704 ATGAATGCATGGATGATGAATGG - Intergenic
1160767912 19:816612-816634 ATGAATGGCTGGATGATGAATGG - Intronic
1160926824 19:1550428-1550450 ATGGATGGATGGATGTTGAATGG - Intergenic
1160960241 19:1717713-1717735 ATGGATGGATGGATGGAACATGG + Intergenic
1160960331 19:1718117-1718139 GAGAATGGATGGATGATAAATGG + Intergenic
1161090592 19:2358094-2358116 ATGGACAGACGGACGGTAAATGG - Intergenic
1161105282 19:2440782-2440804 ATGAGTAGATGGATGGATGATGG - Intronic
1161115193 19:2492919-2492941 AGAAATAGAGGGATGATAAACGG + Intergenic
1161242749 19:3231613-3231635 ATAGATGGATGGATGGTAGATGG + Intronic
1161242807 19:3231874-3231896 ATGAATAGATGGATGGATGATGG + Intronic
1161242828 19:3231988-3232010 ATGAATGGATGGATGGATGATGG + Intronic
1161287320 19:3475548-3475570 GTGGATAGATGGATGATGAATGG + Intronic
1161632895 19:5367876-5367898 ATGAATGGATGGATGGGTTACGG + Intergenic
1161633118 19:5369339-5369361 ATGAATAGATGGATGATGGATGG - Intergenic
1161934477 19:7363172-7363194 ATGGATAGATGGAAGGAAAGAGG + Intronic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1162755807 19:12858972-12858994 AAGGATAGATGGATGGATAATGG - Intronic
1163095034 19:15051049-15051071 ATTAATGGATAGATGGTAGATGG + Intronic
1163347690 19:16754245-16754267 ATGGATAGATGGATGGAAGATGG - Intronic
1163382656 19:16979048-16979070 AAGAATAGATGGATGGATAGTGG - Intronic
1163382667 19:16979097-16979119 ATGGATAGATGGATGGATAGTGG - Intronic
1163382681 19:16979163-16979185 ATGAATGGATGGATGGATAGTGG - Intronic
1163382700 19:16979263-16979285 ATGGATGGATGGATGGCTAATGG - Intronic
1163383596 19:16985502-16985524 ATGGATGGATGGATGATAAATGG + Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163609958 19:18295568-18295590 ATGGATGGGTGGATGGTGAATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163894173 19:20042721-20042743 ATTAATAAAGGGATGGGAAATGG - Intergenic
1164597775 19:29541457-29541479 ATGAATAGATGGGTGGATGATGG + Intronic
1164670297 19:30068536-30068558 ATGGATAGATGGATGATGGATGG - Intergenic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164719687 19:30423267-30423289 ATGAATAGATGGGTGGTAGATGG - Intronic
1164920545 19:32085445-32085467 ATGGATGGATGGATGATGAATGG + Intergenic
1165098346 19:33422693-33422715 ATGGGTAGATGGATGGTAGATGG - Intronic
1165322456 19:35094387-35094409 ATGAGTGGATGGATGATAGATGG - Intergenic
1165759164 19:38310463-38310485 ATGGATGGATGGATGATAGATGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1167086853 19:47315932-47315954 ATGGATGGATGGATGGATAATGG - Intronic
1167233848 19:48302112-48302134 ATGAATGGATGGATGGATATAGG + Intronic
1168330930 19:55568082-55568104 ATGCATAGATGGATGGATGATGG + Intergenic
1168330961 19:55568266-55568288 ATGAATAGATGGATGGATTATGG + Intergenic
1168330965 19:55568293-55568315 ATGTATAGATGGATGGCTGATGG + Intergenic
1168508267 19:56954585-56954607 ATGGATGGATGGATGGATAAGGG - Intergenic
1168635882 19:57996510-57996532 ATAAATAAATGGCTGGTAAGGGG + Intronic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
925925605 2:8667993-8668015 ATGAATGGATGGATGGATGAAGG + Intergenic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926223254 2:10949970-10949992 ATGGATGGATGGATGGGTAAAGG + Intergenic
927103264 2:19804196-19804218 ATGCATAGATGGATGATTAAAGG + Intergenic
927287842 2:21375284-21375306 ATGAATAGATGGGGGATAATAGG + Intergenic
927811649 2:26183799-26183821 ATGAATTGATGGATAAGAAAAGG - Intronic
928077236 2:28276181-28276203 AAGAATAAAGAGATGGTAAAAGG + Intronic
928234060 2:29524824-29524846 ATGAATGGATGGATGGTAGATGG + Intronic
929392096 2:41481597-41481619 AAGAATAGATGGGTAGTAATAGG + Intergenic
929491479 2:42400418-42400440 AGGAACAGAGGGATGGCAAATGG - Intronic
930003740 2:46879801-46879823 GTGAATGGATGGATGGTGAGTGG + Intergenic
930255697 2:49087680-49087702 ATGCATAGTTGGGTGGTAGATGG + Intronic
930267702 2:49219259-49219281 ATGGATGGATGGATGGTAGGCGG - Intergenic
930497169 2:52160466-52160488 ATCAACAGATGGATGGATAAAGG - Intergenic
930903607 2:56538423-56538445 ATGAATGCATGGAAGGTAAGTGG + Intergenic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931169181 2:59784538-59784560 ATGAATAGATGGATGATGAATGG + Intergenic
931197036 2:60062359-60062381 ATGAATACATTCAAGGTAAATGG - Intergenic
931256673 2:60580258-60580280 ATCAAAAGGTGGATGCTAAAAGG + Intergenic
931367726 2:61633900-61633922 AGGAATAGAGGGATGGCAGATGG - Intergenic
931479501 2:62626491-62626513 ATCAATAGATGAATGGATAAAGG - Intergenic
931568128 2:63638155-63638177 ATGAAGAGATGGTGGGCAAAGGG + Intronic
933031964 2:77339717-77339739 AAGAAAAGATGGAAGGTAAGAGG + Intronic
933296812 2:80500360-80500382 ATGAATGGATGGATAATAGATGG - Intronic
933382945 2:81573060-81573082 AAGAATAGAGGGATTGGAAAGGG - Intergenic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
933968216 2:87447991-87448013 CTGGATGGATGGATGGTAGATGG + Intergenic
934070698 2:88381428-88381450 TTGAATAGGTGGTGGGTAAATGG + Intergenic
934613919 2:95759781-95759803 ATGAATGGATGGATGGCAGATGG + Intergenic
934613923 2:95759800-95759822 ATGGATGGATGGATGGCAGATGG + Intergenic
934613928 2:95759819-95759841 ATGGATGGGTGGATGGTAGATGG + Intergenic
934613958 2:95760055-95760077 ATGAGTAGATGGATGCTAGATGG + Intergenic
934613974 2:95760158-95760180 AAGAATGGATGGATGGTAGATGG + Intergenic
934646954 2:96064395-96064417 ATGAATGGATGGATGGTAGATGG - Intergenic
934646988 2:96064630-96064652 ATGAATGGATGGATGGTAGATGG - Intergenic
934647005 2:96064745-96064767 ATGAATGAATGGATGGTAGATGG - Intergenic
934647022 2:96064860-96064882 ATGGATGGATGGATGGTAGATGG - Intergenic
934647026 2:96064879-96064901 ATGGATGGATGGATGGTAGATGG - Intergenic
934781924 2:96975698-96975720 ATGTGTAGATGGAAGATAAAGGG - Intronic
934840380 2:97620621-97620643 ATGAATGAATGGATGGTAGATGG - Intergenic
934840395 2:97620724-97620746 ATGGATGGATGGATGGTAGATGG - Intergenic
935127995 2:100240822-100240844 AGGAAGAGAGGGATGGAAAATGG - Intergenic
935610563 2:105020051-105020073 ATGAATAGATTGAAAGTGAAAGG + Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
935782255 2:106518670-106518692 AGGAATGAATGGATGGTGAATGG - Intergenic
936325581 2:111502513-111502535 CTGGATGGATGGATGGTAGATGG - Intergenic
937065820 2:119016803-119016825 ATGAATAGATAGATGGATACAGG + Intergenic
937548459 2:123055339-123055361 ATGCAAAGGAGGATGGTAAAGGG - Intergenic
937706066 2:124922158-124922180 AAGTATAGATGGAAGGTAAGTGG + Intergenic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
939294994 2:140250475-140250497 GTCAATAGCTGCATGGTAAAGGG + Intronic
939337981 2:140855615-140855637 ATAAAGAGCTGGAGGGTAAATGG - Intronic
939550702 2:143611864-143611886 ATGAACATAGGGGTGGTAAAGGG - Intronic
939679296 2:145110468-145110490 ATGAATAAATAGATGATGAATGG + Intergenic
940139950 2:150483032-150483054 AGGAAGAGATGGATGGAGAAAGG + Intronic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941529300 2:166645832-166645854 ATGAATAGATTGAAAGTAAATGG - Intergenic
941750662 2:169132087-169132109 ATGAATAGATGGATGATGAATGG + Intronic
942358835 2:175149822-175149844 AGGAATGGATGAATGGGAAATGG - Intronic
942761313 2:179401008-179401030 ATGTATAGATGGATGTTCATAGG - Intergenic
943014290 2:182492430-182492452 GTGAACTGATGGATGATAAATGG + Intronic
943430046 2:187788375-187788397 ATCAACAGATGGATGGATAAAGG + Intergenic
945159532 2:206874981-206875003 ATGAATAGATGGATGAATGATGG - Intergenic
945504130 2:210616940-210616962 ATGTATAGATTGATATTAAAAGG - Intronic
945992467 2:216407736-216407758 ATGAAAAGAAGGAAGGAAAATGG + Intergenic
946414822 2:219534758-219534780 ATGGATGGATGGATGGCAGATGG - Intronic
947697830 2:232207373-232207395 ATGAACAGATTGATGGTAATAGG - Intronic
947964381 2:234267219-234267241 ATGAAGAGATGGATGGGAGGTGG - Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
1170379194 20:15737876-15737898 ATGGATGGATGGATGATGAATGG + Intronic
1170729532 20:18961162-18961184 GTGAATAGGTGGATGCTGAAGGG + Intergenic
1170956595 20:20985636-20985658 ATGAATGAATGAATGGTGAATGG - Intergenic
1171084611 20:22225958-22225980 ATGAATAGAATGATTGCAAATGG - Intergenic
1171240015 20:23559606-23559628 ATGAATAGGTTGAAAGTAAAGGG - Intergenic
1172230773 20:33334154-33334176 ATGGGTAGATGGATGGTGGATGG + Intergenic
1172782055 20:37442702-37442724 ATGGATGGATGGATGATGAATGG - Intergenic
1173826237 20:46049477-46049499 ATGAATGGATGGGTGGTGAGGGG + Intronic
1173871498 20:46344890-46344912 ATGGATGAATGGATGGTAGATGG - Intergenic
1174125625 20:48303018-48303040 ATGAATGGATGGATGAAGAATGG - Intergenic
1174175343 20:48640990-48641012 ATGGATAGCTAGATGATAAATGG + Intronic
1175138018 20:56839607-56839629 ATGGATGAATGGATGGTAAGTGG + Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1175221172 20:57417361-57417383 ATGTATGGATGGAGGGTGAATGG + Intergenic
1175277279 20:57780829-57780851 ATGGATAGATGGATGATAGGTGG - Intergenic
1175302009 20:57949432-57949454 ATGGATGGATGGATGGCAGATGG + Intergenic
1175375361 20:58520166-58520188 ATGAGTGGATGGGTGGTAAGTGG + Intergenic
1175486664 20:59351852-59351874 ATGGATAGATGGATGATTAATGG - Intergenic
1175493234 20:59393358-59393380 ATGGATGGATGGGTGATAAATGG - Intergenic
1175493239 20:59393381-59393403 ATGATTAGATGGATGACAGATGG - Intergenic
1175687942 20:61045036-61045058 ATGGATGGATGGATGGTCAATGG - Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175688001 20:61045319-61045341 ATGCATGGATGGATGGTGAAAGG - Intergenic
1175688013 20:61045398-61045420 ATGGATAGAAGCATGGTGAATGG - Intergenic
1175745797 20:61456104-61456126 ATGGATAGATGGATGGAGAGTGG + Intronic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175781069 20:61682388-61682410 ATGGATAGATGGATGGACAGAGG + Intronic
1175798981 20:61790219-61790241 ATGAATGGATGGATGGTAGGTGG - Intronic
1175799056 20:61790661-61790683 ATGAATGGATGGATGGTGGGTGG - Intronic
1175799084 20:61790824-61790846 ATGAATGGATGGATGGTGGGTGG - Intronic
1175799097 20:61790887-61790909 ATCAATGGATGGATGGTAGGTGG - Intronic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817344 20:61890199-61890221 ATGGATAGATGGATGTTGGATGG + Intronic
1175817364 20:61890310-61890332 ATGGATAGATGGATGATGGATGG + Intronic
1175817421 20:61890599-61890621 ATGGATGGATGGATGGGTAAGGG + Intronic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175817979 20:61893472-61893494 ATGAGTAGAGGGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1176047147 20:63098679-63098701 ATGAATTGATGGATGGATGATGG + Intergenic
1177433332 21:21019002-21019024 CTGAATGGTTGGATGCTAAATGG + Intronic
1177652372 21:23974423-23974445 ATCAACAGATGAATGGTTAAAGG + Intergenic
1178052269 21:28760943-28760965 ATGAATAGATCTATGACAAAAGG - Intergenic
1178280856 21:31281637-31281659 ATAAATAGGTGGATGGTAGATGG + Intronic
1178280895 21:31281864-31281886 GTGGATAGATGGATGGTAGATGG + Intronic
1178368634 21:32008836-32008858 ATGGATGGATGGATGGTGAATGG + Intronic
1178788761 21:35678546-35678568 ATGAATGTATGAATGATAAATGG + Intronic
1178788773 21:35678627-35678649 ACGAATGGATGTATGATAAATGG + Intronic
1178788791 21:35678714-35678736 ATGGATGGATGGATGATGAATGG + Intronic
1178907847 21:36651116-36651138 ATGAATGGATGGATGGACATAGG - Intergenic
1178926462 21:36779375-36779397 ATGGATGGATGGGTGGTAGATGG - Intronic
1179125936 21:38590644-38590666 ATGAATACATGGATGATGGATGG - Intronic
1179474384 21:41633982-41634004 ATGAATGAATGGGTGGTAGATGG - Intergenic
1179474710 21:41635756-41635778 ATAGATGGATGGATGATAAATGG - Intergenic
1179474751 21:41636035-41636057 ATGGATGGATGGATGATGAATGG - Intergenic
1179474764 21:41636106-41636128 ATGAATGGATGGATGATGGATGG - Intergenic
1179549121 21:42132178-42132200 ATGGATGGATGGATGATAGATGG - Intronic
1179549176 21:42132561-42132583 ATGAACAGATGGATGGATGATGG - Intronic
1179587834 21:42385016-42385038 AGGAAGAGAGGGAGGGTAAAAGG - Intronic
1180642364 22:17309521-17309543 ATGAAAAGCTGGTTGGAAAAGGG + Intergenic
1181002442 22:19994218-19994240 ATGAATGGATGGATGGGGGATGG + Intronic
1181537182 22:23552523-23552545 AGGAATGGATGGAAGATAAATGG - Intergenic
1181958979 22:26609466-26609488 ATGAATGGATGCATGGATAAAGG + Intronic
1182031633 22:27163593-27163615 ATGAATGGATGGATAATATATGG + Intergenic
1182039074 22:27222346-27222368 ATAGATAGATGGATGACAAATGG + Intergenic
1182042190 22:27246870-27246892 ATGAATTGGTGGATGATAGATGG + Intergenic
1182048503 22:27295734-27295756 ATGGATGGATGGATGGATAATGG + Intergenic
1182086638 22:27565500-27565522 ATGGATAGATGGATGGATGATGG + Intergenic
1182995791 22:34810830-34810852 TTTAATAAATGGGTGGTAAATGG + Intergenic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183262319 22:36803617-36803639 ATGGATAGAGGGATGGATAAAGG + Intronic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1183303975 22:37072197-37072219 ATGAATGGATGGATGGATGATGG + Intronic
1183304000 22:37072326-37072348 ATGAATGGATGGATGATGGATGG + Intronic
1183304039 22:37072546-37072568 ATGAATGGATGGATGATGGATGG + Intronic
1183304081 22:37072753-37072775 ATGGATAGATGGATGATGGATGG + Intronic
1183304107 22:37072901-37072923 ATGGATAGATGGATGATGTATGG + Intronic
1183304123 22:37072984-37073006 ATGGATAGATGGATGATGGATGG + Intronic
1184285714 22:43470185-43470207 ATGGATAGATGGATGGTTTATGG - Intronic
1184285728 22:43470310-43470332 ATGGATAGATGGCTGGTTTATGG - Intronic
1184293046 22:43508502-43508524 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293053 22:43508525-43508547 ATGGATGGATGGATGGGAGATGG - Intergenic
1184293214 22:43509056-43509078 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293321 22:43509408-43509430 ATGGATAGATGGATGGGGGATGG - Intergenic
1184293388 22:43509661-43509683 ATGGATGGATGGATGATAGATGG - Intergenic
1184293432 22:43509800-43509822 ATGGATGGATGGATGGAAAGAGG - Intergenic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410518 22:44323437-44323459 ATGGATGGATGGATGGTTGATGG - Intergenic
1184410529 22:44323500-44323522 ATGGATGGATGGATGGTTGATGG - Intergenic
1184410564 22:44323640-44323662 ATGGATGGATGGATGGTGAGTGG - Intergenic
1184460213 22:44633616-44633638 ATGAGTGGATGGATGATGAATGG + Intergenic
1184460243 22:44633795-44633817 ATGAGTAGATGGATGATGAATGG + Intergenic
1184460756 22:44636631-44636653 ATGGATAGATGGATGGATATAGG + Intergenic
1184460829 22:44636927-44636949 ATGGATAGATGGATGATGGATGG + Intergenic
1184460851 22:44637034-44637056 ATGGATAGATGGATGATGGATGG + Intergenic
1184460874 22:44637133-44637155 ATGGATAGATGGATGATGGATGG + Intergenic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
1184880683 22:47302594-47302616 ATGGATGGATGGATGATGAATGG - Intergenic
1184991045 22:48170278-48170300 ATGAATGAATGGATGGAAAGAGG - Intergenic
1185005498 22:48274179-48274201 ATGAATGGATGGATGGATGAAGG - Intergenic
1185018830 22:48361524-48361546 ATGGATAGATGGATGATAGATGG + Intergenic
1185018853 22:48361712-48361734 ATGGATAGATGGATGATGGATGG + Intergenic
1185053521 22:48566117-48566139 ATGGATGGATGGATGATGAATGG + Intronic
1185104449 22:48859291-48859313 ATGAATGGATGGATGGATGATGG - Intergenic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185154565 22:49185410-49185432 ATGGATGGATGGATGGTGAATGG - Intergenic
1185165588 22:49260426-49260448 ATGAATGGATGGATGATGGATGG - Intergenic
1185193381 22:49452836-49452858 ATGAATAGATGGATCATGAATGG + Intronic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196874 22:49477140-49477162 GTGGATGGATGGATGGTGAATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
950081405 3:10224776-10224798 ATGGATGGATGGGTGGTAGATGG - Intronic
950177749 3:10887187-10887209 ATGGATAGATGAATGATAAATGG + Intronic
950177755 3:10887237-10887259 ATGCATGGATGGATGATGAATGG + Intronic
950651778 3:14411754-14411776 ATGGATTGATGGATGGTGACAGG - Intronic
950657651 3:14446987-14447009 ATGGATAGATGGATGGAAAATGG - Intronic
950987123 3:17385615-17385637 ATGAACAGATGAATGTAAAATGG - Intronic
951364738 3:21767641-21767663 ATGAATTGATGAGTGGTGAATGG + Intronic
951477822 3:23127051-23127073 AAGAATAAATGGATGTTAGAAGG - Intergenic
951779149 3:26343484-26343506 ATGCATAAATAGAGGGTAAAAGG - Intergenic
951798695 3:26571146-26571168 ATGAATGGATGAATGGATAAAGG - Intergenic
952109496 3:30106289-30106311 ATCAATAGATGAATGGATAAAGG - Intergenic
952280704 3:31920582-31920604 TTAAGTAGATGGATGGTAGATGG + Intronic
952446555 3:33386457-33386479 ATGAATGGATGCATGTAAAATGG + Exonic
952571316 3:34720921-34720943 ATATATAGATGGGTGATAAAGGG + Intergenic
953397325 3:42583429-42583451 ATAAATGGATGGATGGTGCAGGG + Intronic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
954240074 3:49286770-49286792 ATGGATAGATGGATGGATGATGG - Intronic
955215845 3:56984379-56984401 ATGGATGGATGGTTGGTAAGTGG + Intronic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956575046 3:70743390-70743412 GTGAAAAGATGGATGATTAAAGG - Intergenic
956642374 3:71427276-71427298 ATGAATAAATGGATACAAAACGG + Intronic
956873857 3:73443125-73443147 ATGAATAGGTGGAAGGTATGAGG - Intronic
957433277 3:80141911-80141933 CTGAGTAGGTAGATGGTAAAAGG - Intergenic
957609066 3:82443937-82443959 ATAAATAAATAGATGTTAAAGGG + Intergenic
958884879 3:99714613-99714635 ATGGATAAATGGATGGAAACAGG - Intronic
959655241 3:108796820-108796842 ATCAAGTAATGGATGGTAAAAGG + Intergenic
960326439 3:116301660-116301682 ATGAATATATGCATGAGAAATGG - Intronic
961113596 3:124307939-124307961 ATAAATAGATGGAAAGTAAAAGG + Intronic
961732410 3:128975572-128975594 ATGAATGGATGGATGGGGATGGG + Intronic
963766004 3:149336511-149336533 ATGAAGAGAGGGATGGGCAAAGG + Intergenic
965409164 3:168307767-168307789 ATGGATAGATGGATGGGTAGGGG + Intergenic
965690024 3:171345946-171345968 ATGGATGGATGGATGGTAGATGG + Intronic
965691399 3:171360737-171360759 ATGAATAGATGTATGTGGAAGGG - Intronic
965833319 3:172823107-172823129 ATGAATAGAAAGATGTAAAAAGG + Intergenic
968364820 3:198176050-198176072 TAGAAAAGATAGATGGTAAATGG + Intergenic
968594604 4:1475937-1475959 ATGAATAGATGGGTGGATGATGG + Intergenic
968598371 4:1496920-1496942 ATGGATGGATGGATGGATAATGG + Intergenic
968598424 4:1497280-1497302 ATGGATGGATGGATGGATAATGG + Intergenic
968761895 4:2446782-2446804 ATTATCAGATGGATGGTAGATGG + Intronic
968761954 4:2447096-2447118 ATGGATGGATGGATGATAGATGG + Intronic
968924797 4:3541562-3541584 GGGAATAGATGGATGCTGAATGG + Intergenic
969424819 4:7118049-7118071 ATGGATAGATGGATGGTGGGTGG + Intergenic
969424852 4:7118201-7118223 ATGGAGAGATGGATGGGAGATGG + Intergenic
969465123 4:7351776-7351798 ATAGATGGATGGATGATAAATGG - Intronic
969502505 4:7561688-7561710 ATGAATGGATGGTAGATAAATGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510728 4:7616338-7616360 ATGAATAGGTGGATGGTGGATGG - Intronic
969510863 4:7617151-7617173 TTGGATAGATGGATGGTGGATGG - Intronic
969514943 4:7641945-7641967 ATGAATGGATGGATGGTAGATGG + Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
969612265 4:8234017-8234039 ATGAATGGATGGATGGATGATGG - Intronic
969612271 4:8234055-8234077 ATAAATGGATGGATGATAAAAGG - Intronic
969612290 4:8234175-8234197 ATGAATGGATGGATGATGGATGG - Intronic
969687536 4:8684030-8684052 TTGAATAGATAGATGCTAGATGG + Intergenic
970064300 4:12074355-12074377 ATGAATAGAGGGATGGTGTAAGG - Intergenic
970181561 4:13402579-13402601 AGAAATAGAAGGATGGGAAAAGG - Intronic
970479572 4:16459377-16459399 ATGGACAGGTGGATGGTAGACGG - Intergenic
970507464 4:16745912-16745934 CTGAATAGTGGGATGGTAAAGGG + Intronic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
971811726 4:31436551-31436573 ATAATTAAATGGATGGAAAATGG + Intergenic
971819632 4:31534553-31534575 ATCAGTAAATGGATGGTAAATGG - Intergenic
971936597 4:33157317-33157339 ATCAATAGATGAATGGATAAAGG + Intergenic
974361645 4:60888497-60888519 ATGAATACATGAATGACAAATGG - Intergenic
974388519 4:61233985-61234007 ATGAAAAAATTGATGGGAAAGGG + Intronic
974485016 4:62493771-62493793 ATGAAGAGCTTGATGGGAAATGG + Intergenic
975094942 4:70446707-70446729 AAGAAGAGAAGCATGGTAAATGG - Intronic
975526485 4:75356052-75356074 ATGAAAAGATGGAAGGAAACGGG + Intergenic
976106629 4:81625852-81625874 CTGAATGGATGAATGGGAAAGGG - Intronic
976312381 4:83624687-83624709 AAGAATACATGGAAGATAAAAGG - Intergenic
977426721 4:96875916-96875938 ATGAATAGATGAATGAACAAAGG + Intergenic
979062023 4:116075712-116075734 ATCAATAGGTTGATAGTAAAAGG - Intergenic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979559352 4:122084455-122084477 ATGAATAGGTACATGGTATAAGG - Intergenic
979689610 4:123546735-123546757 ATGACTTGGTGGTTGGTAAATGG + Intergenic
980308566 4:131098520-131098542 ATGAATGAATGAGTGGTAAACGG - Intergenic
981818234 4:148855770-148855792 TTTAATAGATGGATGATAAATGG - Intergenic
983325330 4:166248038-166248060 ATGAAGAGATGGATGTAGAATGG + Intergenic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
984330365 4:178307586-178307608 ATGAATAGATAAATGGAAAGAGG + Intergenic
984864595 4:184270930-184270952 ATGGATAGATGGATGGATAGAGG - Intergenic
985709207 5:1418855-1418877 ATGGATGGATGGATGGATAATGG - Intronic
985709221 5:1418929-1418951 ATGGATGGATGGATGATGAATGG - Intronic
985829693 5:2219323-2219345 ATGGATGGATGGATGGTAGATGG - Intergenic
985829701 5:2219362-2219384 ATGAATGGATGGATTATGAATGG - Intergenic
985829711 5:2219413-2219435 ATGAATGGATGGATGTTGAATGG - Intergenic
986072879 5:4304430-4304452 ATGAATAGATGGATGATGGATGG - Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
986413919 5:7509235-7509257 ATGAATGCATGCATGGTGAATGG + Intronic
987068021 5:14308642-14308664 ATGGATGGATGGATGATGAATGG - Intronic
987948575 5:24647857-24647879 ATGAATAAATGAAATGTAAAAGG + Intergenic
988405049 5:30813706-30813728 AAGAATAGATTAAAGGTAAAAGG + Intergenic
989303320 5:39920438-39920460 ATGAAAAGAAGGATGTTATAAGG + Intergenic
990521686 5:56587465-56587487 ATGAATGAATGGATGGGATAGGG - Intronic
993096416 5:83484318-83484340 ATGAATAGATAGATGATGGATGG - Intronic
993215485 5:85017781-85017803 ATGAATATATGAATGGTACCTGG + Intergenic
993423325 5:87730025-87730047 CAGAATAGTTGGATGGTATAAGG - Intergenic
993527273 5:88981062-88981084 ATGTATAGATGGATGGATAGAGG - Intergenic
995351792 5:111185544-111185566 ATGAATAGATGAACAGAAAATGG - Intergenic
995655107 5:114417606-114417628 ATAGATAGTTGGGTGGTAAAAGG + Intronic
995882318 5:116856977-116856999 ATGAAGAGATGGAAAGAAAAAGG - Intergenic
996332681 5:122348360-122348382 TTGAATAGTGGGATGGTAAAAGG + Intronic
996898211 5:128511675-128511697 ATGGATATATGGCAGGTAAAAGG + Intronic
996904417 5:128581805-128581827 AATAATAGATGGATGGCAGATGG + Intronic
997404810 5:133637016-133637038 ATAAGTAGAGGGATAGTAAAAGG + Intergenic
997494886 5:134314806-134314828 AAGAAAAGATGAATTGTAAAAGG + Intronic
999031890 5:148302865-148302887 TTGAATAGATAGATGTTGAATGG + Intergenic
999067604 5:148707008-148707030 ATAAATAGATTGAAAGTAAAAGG + Intergenic
999273013 5:150308786-150308808 CTGGATATATGGAAGGTAAATGG + Intronic
1001147556 5:169198033-169198055 ATGCATAGATGGATGGTGGTTGG - Intronic
1001254220 5:170171347-170171369 ATGGATAGATGGATGGAGAGTGG + Intergenic
1001272567 5:170326116-170326138 ATGAATTGATGGATGGGTAAAGG + Intergenic
1001422550 5:171598812-171598834 GTGGATAGGTGGATGGTAGATGG + Intergenic
1001646256 5:173284368-173284390 ACGAATAGATGGATGGTGGATGG - Intergenic
1001740843 5:174051568-174051590 ATGGATGGATGGATGATGAATGG - Intronic
1001751428 5:174134481-174134503 ATGAATTGATGAATGGAAGATGG - Intronic
1001751459 5:174134668-174134690 ATGGATGGATGGATGGATAATGG - Intronic
1001751463 5:174134687-174134709 ATGGATTGATGGATGATGAATGG - Intronic
1001751490 5:174134866-174134888 ATTGATGGATGGATGGAAAATGG - Intronic
1001751495 5:174134893-174134915 ATGGATGGATGGATGATGAATGG - Intronic
1001865673 5:175102995-175103017 ATGAATGGATGGATGATGAATGG + Intergenic
1001865678 5:175103026-175103048 ATGGATAGATGGATGATGGATGG + Intergenic
1002376988 5:178795985-178796007 AAGAAAAGATGAAAGGTAAAGGG + Intergenic
1002511329 5:179720406-179720428 ATGAAGACATGGATGGAGAATGG + Exonic
1002766994 6:249855-249877 ATCAATAGATGAATGGATAAAGG - Intergenic
1003520586 6:6855434-6855456 TTGAATGAATGGATGGAAAATGG - Intergenic
1003972550 6:11313138-11313160 ATGAATAGATGGATGGTTGGTGG + Intronic
1003972566 6:11313236-11313258 ATGAATAGATAGATGGTGGGTGG + Intronic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1004077312 6:12356320-12356342 CTGAATAGAAGCATGGTATATGG - Intergenic
1005190760 6:23220454-23220476 AAGAATAGATGAATAGTAGATGG - Intergenic
1006370225 6:33639734-33639756 ATGAATAGATGGATGATTGGGGG + Intronic
1006598507 6:35210891-35210913 AAAAATAGATGGCTGGGAAATGG + Intergenic
1006706141 6:36023158-36023180 ATGGATGGATGGATGGATAAGGG - Intronic
1007352067 6:41281181-41281203 ATGGACAGATGGATGATGAATGG + Intronic
1007769514 6:44181306-44181328 CTCAAGAAATGGATGGTAAAGGG + Exonic
1008102195 6:47404004-47404026 ATGAGGAGGTGGATGGTCAAAGG - Intergenic
1008383846 6:50864628-50864650 ATGAAAGGATAGAAGGTAAAGGG - Intergenic
1008422134 6:51313636-51313658 ATGAATGGATGGATGATGGATGG - Intergenic
1010634030 6:78234476-78234498 CTGAATAGAAGGATGGGAAGTGG - Intergenic
1012266814 6:97155040-97155062 ATAAATAGATTGAAAGTAAAAGG - Intronic
1012495679 6:99831195-99831217 ATGTATATATGAATGGTAAGTGG + Intergenic
1013140830 6:107332895-107332917 TTGTATGGATGAATGGTAAAAGG + Intronic
1013252262 6:108346016-108346038 AAGACTACATGGCTGGTAAATGG + Intronic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1014060491 6:117066025-117066047 AGGAAGTGATGGATGGTTAATGG - Intergenic
1016522057 6:144956720-144956742 ATGGATAGATAGATGATAGATGG - Intergenic
1016522060 6:144956804-144956826 ATGGATAGATAGATGATAGATGG - Intergenic
1016522064 6:144956910-144956932 ATGGATAGATAGATGATAGATGG - Intergenic
1016522065 6:144956929-144956951 ATGGATAGATAGATGATAGATGG - Intergenic
1016739883 6:147515545-147515567 ATGGAGAGATGGATGGGTAAAGG - Intronic
1016869989 6:148807409-148807431 ATGACCACATGGTTGGTAAATGG - Intronic
1018133288 6:160752811-160752833 ATGTATATATGGATAGTAGAAGG + Intronic
1018335448 6:162783144-162783166 ATGAATATGTAGAGGGTAAAAGG + Intronic
1019326849 7:442703-442725 ATGGATGGATGGATGGTAGATGG + Intergenic
1019326889 7:442901-442923 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326903 7:442969-442991 ATGAATAGATGGATGGATGGTGG + Intergenic
1019326912 7:443018-443040 ATGAATGGATGGAGGATGAATGG + Intergenic
1019326922 7:443064-443086 ATGAATAGATGGATGGATGGTGG + Intergenic
1019327000 7:443437-443459 ATGGATGGATGGATGGTGAATGG + Intergenic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1019345529 7:528229-528251 ATGAATAGATAGATGATTGATGG + Intergenic
1019345542 7:528314-528336 ATGAATGGATGGATGGATTATGG + Intergenic
1019345591 7:528686-528708 ATGAATGGATGGATAGACAATGG + Intergenic
1019555833 7:1630894-1630916 ATAAATGGATGGATGGTGGATGG - Intergenic
1019776027 7:2912715-2912737 ATGGATGGATGGATGGATAAGGG - Intronic
1019914649 7:4124975-4124997 ATGTATGGATGGATGATAGATGG + Intronic
1019914661 7:4125042-4125064 ATGGATGGATGGATGGGTAATGG + Intronic
1019914699 7:4125219-4125241 ATGGATAGATGGATGATGGATGG + Intronic
1019914705 7:4125246-4125268 ATGAATGGATGGATGGGTGATGG + Intronic
1019914734 7:4125396-4125418 ATGGATAGATGGATGGATGATGG + Intronic
1019932128 7:4230568-4230590 ATGAATGGATGGATAATGAATGG + Intronic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1020573625 7:9897564-9897586 ATCAACAGATGAATGGAAAAAGG + Intergenic
1020699575 7:11462977-11462999 ATGAATAGCTGCATGGCACAGGG + Intronic
1020999097 7:15305164-15305186 GAGAATAGCAGGATGGTAAAAGG - Intronic
1021352052 7:19605873-19605895 ATGAAAAGAAGGAGGGGAAAGGG - Intergenic
1021532385 7:21662381-21662403 ATGAATTGATGGATGGTTATAGG - Intronic
1022148352 7:27571122-27571144 ATTAATAGATAAATGGTATATGG - Intronic
1022908979 7:34882095-34882117 ATGAATGGATGGATGGATGATGG + Intergenic
1023116446 7:36867196-36867218 ATGGATAGATGGATGATGGATGG - Intronic
1024407741 7:49001965-49001987 ATGACCAGCTGGATGGTAGAGGG - Intergenic
1024694506 7:51840986-51841008 ATGAATAGATGAAAGATAGACGG + Intergenic
1024960976 7:54975963-54975985 ATGAATAGATGGAAGACTAATGG + Intergenic
1025116045 7:56259183-56259205 ATGGATAGATGGATGATGAATGG + Intergenic
1025120103 7:56294618-56294640 ATGAATGGATGGATGGTTGATGG + Intergenic
1025120123 7:56294731-56294753 ATGAATGGATGGATAGTGGATGG + Intergenic
1025120126 7:56294746-56294768 GTGGATGGATGGATGGTGAATGG + Intergenic
1025120134 7:56294787-56294809 ATGAATGGATGAATGGTGGATGG + Intergenic
1026080160 7:67210857-67210879 ATGGATAGATAGATGATAGAAGG - Intronic
1026203538 7:68235740-68235762 ATGAATGGATGGAAGGTGGATGG + Intergenic
1026203569 7:68235926-68235948 ATGAATGGATGCATGGTGGATGG + Intergenic
1026275173 7:68870131-68870153 ATGGATAGATGGTAGGTAGACGG + Intergenic
1026275189 7:68870221-68870243 ATGGATAGATGGATGATGGATGG + Intergenic
1026275192 7:68870244-68870266 ATGAATGGATGGATGATGAATGG + Intergenic
1026275213 7:68870372-68870394 ATGAATGGATGGATGATGGATGG + Intergenic
1026320532 7:69263994-69264016 ATGGATAGATGAATGATGAATGG + Intergenic
1027451605 7:78337885-78337907 ATGGATGGATGGATGGTGATTGG - Intronic
1027459397 7:78434429-78434451 ATAAAGAGATGGATGGAAACAGG + Intronic
1027628186 7:80570167-80570189 ATCAATAGATGAATGGATAAAGG - Intronic
1028299048 7:89173725-89173747 ATAAATGGATGGATGATAAATGG - Intronic
1028427651 7:90707964-90707986 ATGAATAGATGAAAGATTAAAGG + Intronic
1029214706 7:98938587-98938609 ATGAAATGATGGCTGTTAAATGG - Intronic
1029599759 7:101556818-101556840 ATGGATGGATGGATGATAGATGG + Intronic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1031643873 7:124199632-124199654 ATCAATAGATGAATGGATAAAGG + Intergenic
1031653773 7:124325756-124325778 ATCAACAGATGGATGGATAAAGG + Intergenic
1031828723 7:126599952-126599974 ATGAATGGATGAATGGTGGATGG + Intronic
1031890201 7:127285334-127285356 ATAAATAGATGGATTGTACTGGG + Intergenic
1032917579 7:136509800-136509822 ATGAATTGAAGGGTTGTAAATGG + Intergenic
1033125136 7:138700702-138700724 ATGGATGGATGGATGGCAGATGG + Intronic
1033174838 7:139114353-139114375 ATGAATAGATGTATGGAAGTGGG - Intergenic
1033642702 7:143277563-143277585 ATGCATTGATGGATGGATAAAGG + Intergenic
1034883607 7:154780840-154780862 ATGAATAGATGGATGGGTGATGG + Intronic
1034883631 7:154780968-154780990 ATGAATAGATGGATGGTTGATGG + Intronic
1035288524 7:157821985-157822007 ATGAGTAGATGGATGGATGATGG - Intronic
1035288583 7:157822403-157822425 ATGAGTGGATGGATAGTTAATGG - Intronic
1035288644 7:157822822-157822844 ATGGATAGATGGATAGTGGATGG - Intronic
1035452611 7:158988004-158988026 ATGAATTGATGGATGATGCATGG - Intergenic
1035523738 8:295484-295506 ATAAATAGATGGATGATGGATGG - Intergenic
1035996876 8:4557681-4557703 AGGAATAGAAGGAAGGAAAAAGG + Intronic
1036662984 8:10720297-10720319 ATGAATGGATGGATGGAGAGTGG + Intergenic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1037608584 8:20457811-20457833 ATGGATAGATGGATGGAAGCGGG - Intergenic
1037631324 8:20659145-20659167 ATGGAAATATGGATGGTATAGGG - Intergenic
1038325129 8:26567231-26567253 ATGGATAGATGGATGATGGATGG - Intronic
1038325168 8:26567409-26567431 ATGGATGGATGGATAGTAGATGG - Intronic
1038440932 8:27570276-27570298 ATGGATAGCTGGATGGATAAAGG + Intergenic
1038454091 8:27660898-27660920 ATGGATAGATGGATATTATAAGG + Intronic
1038522665 8:28246733-28246755 ATAAATAGACGGATGATAGATGG + Intergenic
1038572904 8:28678410-28678432 AGGAATAGATTAATGGTAGAAGG + Intronic
1038886988 8:31674528-31674550 ATGCATAGATGAAAGATAAACGG - Intronic
1039502569 8:38029741-38029763 ATGGATGGATGGATGTTCAAGGG - Intergenic
1040074092 8:43211983-43212005 AGGATTAAATGGCTGGTAAATGG + Intergenic
1040407009 8:47115217-47115239 AAGAATAGATGAATGCTACACGG + Intergenic
1040777603 8:51065132-51065154 ACAAATAGATTAATGGTAAAAGG + Intergenic
1040936427 8:52786705-52786727 ATGAGTTGATGGATGAGAAAGGG - Intergenic
1041525203 8:58797721-58797743 ATTAATAAATGGATGGCAAGTGG - Intergenic
1042436352 8:68770424-68770446 ATGACTAGTTCAATGGTAAATGG + Intronic
1043245023 8:77987921-77987943 TGGAATAGATTGATGGGAAAAGG - Intergenic
1043333733 8:79148656-79148678 ATGCAGAGCTGGATGGTAAAAGG - Intergenic
1043715726 8:83483545-83483567 ATGTATTGCTGCATGGTAAATGG + Intergenic
1044220837 8:89667752-89667774 AAGAATAGATGGAAGATGAAGGG + Intergenic
1044507215 8:93036004-93036026 ACAAATAGATAGATGGAAAATGG + Intergenic
1045112717 8:98949217-98949239 TGGAATAGGTGGGTGGTAAAAGG - Exonic
1045628598 8:104087387-104087409 ATGGATGGATGGATGGACAAGGG + Intronic
1046052394 8:109039340-109039362 ATAAATGGATGGATGATGAATGG + Intergenic
1046343811 8:112895544-112895566 ATGAATAGGTGGATGTAAGATGG + Intronic
1047041340 8:120999633-120999655 GTGAATAGATATGTGGTAAAAGG - Intergenic
1047228846 8:122978991-122979013 ATGAATAGACGGATGATGGATGG + Intergenic
1047306780 8:123659071-123659093 ATGGATAGATGGATGATGGATGG - Intergenic
1047306784 8:123659094-123659116 ATGAATGGATGGATGGATGATGG - Intergenic
1047306801 8:123659187-123659209 ATGGATAGATGGATGATGGATGG - Intergenic
1047753511 8:127900409-127900431 ATGAAGAGAAGGATGGGGAATGG - Intergenic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048296970 8:133221535-133221557 ATGAATAGGTGGATGATGGATGG + Intronic
1048979784 8:139697087-139697109 GTGAACAGATGGATGGTGGATGG + Intronic
1048989246 8:139751707-139751729 CTGGATGGATGGATGGTAGATGG - Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989302 8:139751990-139752012 ATGGATAGATGGATGGTAGACGG - Intronic
1048989339 8:139752200-139752222 ATGGATGGATGGATGGTAGATGG - Intronic
1048989351 8:139752250-139752272 TTGGATGGATGGATGGTAGATGG - Intronic
1048989360 8:139752292-139752314 GTGGATGGATGGATGGTAGATGG - Intronic
1048989366 8:139752315-139752337 ATGAATGGATGGGTGGTAGATGG - Intronic
1048989386 8:139752402-139752424 ATGGATGGATGGACGGTAGATGG - Intronic
1048989398 8:139752456-139752478 TTGGATAGATGGATGGTAGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1048989430 8:139752618-139752640 ATGGATAGATGGATGGTAGATGG - Intronic
1048989443 8:139752694-139752716 ATGAATGGATGAATGGTAGATGG - Intronic
1048989466 8:139752833-139752855 ATGGATGGATGGATGGTAGATGG - Intronic
1048989491 8:139752941-139752963 ATTGATGGATGGATGGTAGATGG - Intronic
1048989507 8:139753014-139753036 TTGGATGGATGGATGGTAGATGG - Intronic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1048989552 8:139753205-139753227 TTGGATGGATGGATGGTAGATGG - Intronic
1048989562 8:139753251-139753273 TTGGATGGATGGATGGTAGATGG - Intronic
1048989572 8:139753293-139753315 ATGGATGGATGGACGGTAGATGG - Intronic
1048989584 8:139753335-139753357 ATGGATGGATGGATGGTAGATGG - Intronic
1049042119 8:140120502-140120524 ATGGATAGATGGAGGCTAGATGG - Intronic
1049042168 8:140120758-140120780 ATGAATGGATGGATGTTGGATGG - Intronic
1049042177 8:140120812-140120834 ATGGATGGATGGATGTTAGATGG - Intronic
1049233416 8:141495941-141495963 ATGACTGGATGGATGGTGAAAGG - Intergenic
1049320653 8:141994541-141994563 ATGAATGGATGCATGGATAATGG - Intergenic
1049320685 8:141994658-141994680 ATGAATGGATGGATGGATAGTGG - Intergenic
1049320720 8:141994808-141994830 ATGAATGGATGGATGGATAGTGG - Intergenic
1049320748 8:141994905-141994927 ATGAATGGATGGATGGATAGTGG - Intergenic
1049348179 8:142149990-142150012 ATGGATGGATGGATGGTTGAAGG + Intergenic
1049359959 8:142207673-142207695 ATGGGTAGATGGATGGGGAATGG + Intergenic
1049359990 8:142207796-142207818 ATGCATGGATGGATGGGGAATGG + Intergenic
1049364221 8:142228950-142228972 ATGGATAGATGGGTGATGAATGG + Intronic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049401470 8:142429473-142429495 ATGGATGGATGGATGATAGATGG - Intergenic
1049474805 8:142791914-142791936 ATGGATGGATGGATGATGAATGG - Intergenic
1049474881 8:142792463-142792485 ATGGATGGATGGAAGGTGAACGG - Intergenic
1050152933 9:2635111-2635133 ATGAAGAGATGGAAAGAAAATGG + Intronic
1050769095 9:9174303-9174325 ATAAATAGATGAATGAAAAAAGG + Intronic
1050911689 9:11079558-11079580 ATGATTAGAAAGATTGTAAAAGG - Intergenic
1051005955 9:12344887-12344909 ATTAATAGATGAATGGTTAAAGG + Intergenic
1052284760 9:26772421-26772443 ATGAATGGATGGATGGCTTATGG + Intergenic
1052472488 9:28917380-28917402 CTGAATGGATGGGTGGAAAATGG - Intergenic
1052651177 9:31303399-31303421 ATCAGCAGATGGATGGAAAAAGG - Intergenic
1052981352 9:34451993-34452015 TTGACTAGAACGATGGTAAAAGG + Intronic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054145341 9:61557396-61557418 GGGAATAGATGGATGCTGAATGG - Intergenic
1054188275 9:61969583-61969605 GGGAATAGATGGATGCTGAATGG + Intergenic
1054191271 9:61987058-61987080 ATGAATAGATGGATGGATGGTGG - Intergenic
1054454305 9:65421712-65421734 ATGGGTAGATGGATGATGAATGG + Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1054465097 9:65488549-65488571 GGGAATAGATGGATGCTGAATGG - Intergenic
1054647097 9:67600659-67600681 ATGAATAGATGGATGGATGGTGG + Intergenic
1054650239 9:67618993-67619015 GGGAATAGATGGATGCTGAATGG - Intergenic
1054788842 9:69235916-69235938 CTGAATGGAAGGAAGGTAAAGGG + Intronic
1055246597 9:74252822-74252844 ATAAATAGATGGATGGATAGAGG + Intergenic
1055641248 9:78320448-78320470 ATGAATAGATGGGTGGGTGATGG - Intronic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056256194 9:84801798-84801820 GTTAAATGATGGATGGTAAATGG + Intronic
1057082630 9:92184424-92184446 ATGGATAAATGGATGGATAATGG - Intergenic
1057181112 9:93030979-93031001 ACGAATAGTTGGATGGCATACGG + Intronic
1058403970 9:104650631-104650653 ATATATATATAGATGGTAAATGG - Intergenic
1059070110 9:111126537-111126559 CTGCATAGATGGATGGGTAAAGG - Intergenic
1059249706 9:112877600-112877622 GTTAATGGATGGATGGTAGAGGG - Intronic
1059409070 9:114120725-114120747 ATAGATAGATGGATGATGAATGG + Intergenic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1059416513 9:114165934-114165956 ATGGATAGATGGATGGATGATGG - Intronic
1059473643 9:114526314-114526336 ATGAATAGATGACTGGTAGATGG + Intergenic
1059498567 9:114731047-114731069 GTGGATCGATGGATGGTAGAAGG - Intergenic
1059564990 9:115375203-115375225 ATGAATAGATCGACGGTACAAGG + Intronic
1059920741 9:119157548-119157570 ATGAACAGAAGGCAGGTAAAGGG - Intronic
1059977191 9:119730126-119730148 ATGGAAAGATGGATGGGAGAAGG + Intergenic
1060037185 9:120265514-120265536 ATGGATGGATGGATGGAAAATGG + Intergenic
1060517459 9:124274955-124274977 ATGAAAAGATGGATGTGAAAAGG + Intronic
1061244866 9:129396370-129396392 ATGAGAGGATGGATGGTAGATGG + Intergenic
1061399583 9:130361047-130361069 ATGACTGAATGGATGGTGAATGG - Intronic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417482 9:130454941-130454963 ATGGATAGATGGATGATGGATGG - Intronic
1061417498 9:130455025-130455047 ATGAATGGATGGATGATGGATGG - Intronic
1061417513 9:130455109-130455131 ATGAATAAATGGATGATGGATGG - Intronic
1061417529 9:130455215-130455237 ATGAATAGACGGATGGATGATGG - Intronic
1061950523 9:133933489-133933511 ATGGATGGATGGATGGTGAATGG + Intronic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950566 9:133933692-133933714 ATGGATGGATGGATGGTGAGTGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061950652 9:133934063-133934085 ATGGATAGATGGATGGTGAGTGG + Intronic
1061980985 9:134103521-134103543 TTGGATGGATGGATGGTAGATGG - Intergenic
1061980992 9:134103562-134103584 ATGGATGGTTGGATGGTGAATGG - Intergenic
1061981029 9:134103735-134103757 ATGGATAGATGGATGCTGGAAGG - Intergenic
1061981051 9:134103842-134103864 ATGGATAGATGGATGCTGGATGG - Intergenic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1062092322 9:134684956-134684978 ATTAATGGATGGATGGTGGATGG - Intronic
1062092328 9:134684987-134685009 ATTAATGGATGGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092419 9:134685391-134685413 ATTAATGGATGGATGGTGGATGG - Intronic
1062092471 9:134685629-134685651 ATGCATGGATGGATGGTGGATGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062092820 9:134687455-134687477 ATGAATGGATGGATGGATGATGG - Intronic
1062201344 9:135304439-135304461 ATGGATAGATGGATGATGGAGGG + Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248010 9:135579607-135579629 AAGAATGGATGGATGGAAGATGG - Intergenic
1185480461 X:442383-442405 ATGGATAGATAGATGATAGATGG - Intergenic
1185495432 X:550768-550790 ATGAATAGAAGAATGAAAAATGG - Intergenic
1185498480 X:578416-578438 ATGAATAGATAACTGGTAGATGG + Intergenic
1185498684 X:580768-580790 ATGGATAGATAGATGATAGATGG + Intergenic
1185498731 X:581609-581631 ATGAATAGATGAATGACAGATGG + Intergenic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1185581087 X:1211945-1211967 ATGGATGGATGGATGATAGATGG + Intronic
1185597429 X:1315908-1315930 ATGGATAGATTGATGATAGATGG + Intergenic
1185611443 X:1395726-1395748 ATGGATGGATGGATGGATAATGG + Intergenic
1185611447 X:1395745-1395767 ATGGATGGATGGATGGATAATGG + Intergenic
1185611452 X:1395783-1395805 ATGTATAGATGGATGGATGATGG + Intergenic
1185611456 X:1395802-1395824 ATGGATGGATGGATGGATAATGG + Intergenic
1185616500 X:1424990-1425012 ATGGATGGATGGATGGTAGGTGG - Intronic
1185616512 X:1425037-1425059 ATGGATGGATGGATGGTAGGTGG - Intronic
1185622382 X:1460137-1460159 TAGAATAGATAGATGATAAATGG - Intergenic
1185660416 X:1723784-1723806 ATGAATAGATAGATGATAGATGG + Intergenic
1185660425 X:1723929-1723951 ATGAATAGATAGATGATAGATGG + Intergenic
1185762696 X:2700778-2700800 ATAAATGGATGGATGGTAGATGG - Intronic
1185780568 X:2841118-2841140 ATGGATAGATAGATGATAGATGG + Intronic
1185840520 X:3385577-3385599 ATGAATGGATGGATGAAAGACGG + Intergenic
1185874552 X:3691882-3691904 ATGGATGGATGGATGGACAATGG + Intronic
1185883505 X:3761121-3761143 ATGGATACATGCATGGTAGATGG + Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1185925879 X:4145402-4145424 ATGGATGGATGGATGATGAATGG + Intergenic
1186001888 X:5021815-5021837 ATGGATAGATGAATGATAGATGG - Intergenic
1186041842 X:5487854-5487876 ATAGATAGATGGATGATAGATGG - Intergenic
1186045225 X:5528839-5528861 ATCAATAGATAGATGATAGATGG - Intergenic
1186453077 X:9689475-9689497 ATCAATAGAAGGCTGGTAAGAGG - Intronic
1187052707 X:15710295-15710317 ATGAGTGGATGGATGACAAAAGG + Intronic
1187057660 X:15756453-15756475 AGGAATGGTTGGATGCTAAATGG + Intronic
1187119388 X:16388848-16388870 ACGGATAGATGGATGATAAAAGG + Intergenic
1187484084 X:19685601-19685623 ATGGATAGATGGATAGCTAATGG - Intronic
1188619610 X:32203884-32203906 ATTAAAAGAAGGATGTTAAAAGG - Intronic
1189451288 X:41133608-41133630 AAGAATAGCGGGATGGTTAATGG - Intronic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1192198961 X:69051794-69051816 ATGGGTGGATGGATGGAAAATGG - Intergenic
1193595884 X:83444607-83444629 ATCAATACATGGAAGTTAAAGGG - Intergenic
1193698693 X:84739190-84739212 GTGGAGAGATGGATGGTCAAGGG - Intergenic
1194072478 X:89343754-89343776 ATAAATAGAAGAATCGTAAAGGG + Intergenic
1195477894 X:105307848-105307870 AGGAATAGAGGCATGTTAAAAGG - Intronic
1195659303 X:107362516-107362538 ATGCAAAGATGGGTAGTAAAAGG - Intergenic
1195917563 X:109950800-109950822 ATCAACAGATGAATGGTTAAAGG + Intergenic
1196016426 X:110944748-110944770 ATGAATAGATGCAGGGCGAAAGG + Intronic
1196235356 X:113273879-113273901 ATGAATAAGTGAATGGAAAAAGG + Intergenic
1196632176 X:117954414-117954436 ATGGATGGATGGATGGATAAAGG + Intronic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1196753009 X:119134359-119134381 ATCAATAGATGAATGGATAAAGG - Intronic
1197357879 X:125459008-125459030 ATGAAGAAATGGAGAGTAAATGG - Intergenic
1198192895 X:134328375-134328397 ATATATAGATGGAAAGTAAAGGG - Intergenic
1198585820 X:138120610-138120632 ATGAATATGTGGATGCTTAAAGG + Intergenic
1198601328 X:138287126-138287148 ATGAATAAATGAATGTGAAATGG + Intergenic
1198789613 X:140329787-140329809 ATGAATAGGCAGATGATAAATGG - Intergenic
1199385238 X:147215890-147215912 ATGAAGATATGGATGTGAAAGGG - Intergenic
1199595727 X:149504690-149504712 ATGAATGGATAGAAGGTAAAAGG + Intronic
1199755938 X:150865165-150865187 AAGTATAGATGGAGGATAAAGGG + Intronic
1200726718 Y:6679499-6679521 ATAAATAGAAGAATCGTAAAGGG + Intergenic
1200727870 Y:6695275-6695297 ATAAATAGAAGAATCGTAAAGGG + Intergenic