ID: 1185197388

View in Genome Browser
Species Human (GRCh38)
Location 22:49480630-49480652
Sequence CTTTGGGTTTTGTGTCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185197388 Original CRISPR CTTTGGGTTTTGTGTCAAAA GGG (reversed) Intronic
900802665 1:4747064-4747086 CGTCTGGTTTTGTGTCAACATGG - Intronic
902064712 1:13674879-13674901 TTTTCTGATTTGTGTCAAAATGG - Intergenic
902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG + Intronic
902405139 1:16178687-16178709 CTTTGGCTTTGGTGTCAGACAGG - Intergenic
902644144 1:17786541-17786563 GTTTGTTTTTTGTGTCTAAATGG + Intronic
903402587 1:23066774-23066796 ATTTGGTTTTTCTTTCAAAAAGG - Intronic
903686892 1:25138514-25138536 CTTTGTGTTTTGTGTCAATAAGG - Intergenic
904671732 1:32171093-32171115 CTTTGGGTTTTGTGACAAGAAGG + Exonic
907197780 1:52700509-52700531 ATTTCCGATTTGTGTCAAAAAGG - Intergenic
910440519 1:87247018-87247040 CTTTTGGTTTTGTGGCAGACAGG + Intergenic
914381454 1:147120048-147120070 CCTGGGGTTTTGTGTCATCAGGG + Intergenic
914587101 1:149072679-149072701 CCTGGGGTTTTGGGTCAACAGGG + Intronic
914940800 1:152021401-152021423 CCTGGGGTTTTGTGTCATCAGGG - Intergenic
916637352 1:166687235-166687257 CTTTGACTTCTGTGTCCAAAGGG + Intergenic
918430815 1:184458793-184458815 CTTTGTGTTTAGTAACAAAATGG + Intronic
919489038 1:198182332-198182354 TTTTGGCTTCTGTGTCTAAATGG + Intronic
919580010 1:199359684-199359706 CTATGAGTTTTGTTGCAAAAGGG - Intergenic
919675331 1:200376653-200376675 CTTTGGCTTTTGAGTAAAATGGG - Intergenic
921877885 1:220219936-220219958 CATTTTGTTTTGTGTCATAAGGG + Intronic
924577616 1:245294542-245294564 CTTTTGGTTTTTTATCTAAATGG + Intronic
1064117193 10:12588461-12588483 TTTTGGGATTTGTGACAAATAGG + Intronic
1065266376 10:23980537-23980559 CCTCGGGTTTTGTGTGGAAAGGG + Intronic
1066993596 10:42540152-42540174 TTTGGGGATTTGTGTCAAGATGG - Intergenic
1069169925 10:65214059-65214081 CTTTGGGCTTTCAGTCAAAAGGG + Intergenic
1069922197 10:71822614-71822636 CTCTGTGTTTGGTGTCTAAATGG - Intronic
1072507733 10:96085847-96085869 CTTTGTGTTTTCTGTAAAAAAGG + Intergenic
1074146198 10:110719489-110719511 CTTTTGGTTTTGTTTATAAATGG + Intronic
1074711525 10:116181951-116181973 CTTTTTGTTTTGAGTAAAAATGG + Intronic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079865566 11:25729414-25729436 CATTGGGTTTGGTGTGGAAATGG - Intergenic
1082129909 11:48475953-48475975 ATTTGGGTTTTGTTTCCATATGG + Intergenic
1082267323 11:50133098-50133120 CGTTGCATTTTGTATCAAAAAGG - Intergenic
1082288764 11:50345470-50345492 CGTTGCATTTTGTATCAAAAAGG + Intergenic
1083528243 11:63392790-63392812 CATTTGGTTTTGTGTAAAAGTGG - Intronic
1088051127 11:105516888-105516910 CTTTGGGTTTTATGTTAGAAAGG - Intergenic
1088829462 11:113523037-113523059 CTTAGGGTTTTGTCTCAAGCTGG - Intergenic
1092117675 12:6020910-6020932 CTTGGGGTTCTGTGCCAAAAGGG - Intronic
1092403722 12:8200057-8200079 CTCTGGGTTTTCTGTCAGAAAGG + Intergenic
1092667849 12:10824963-10824985 CTTTGGGTTTTCTGGGAGAATGG + Intronic
1094280272 12:28729570-28729592 CTTTGAGTTTAGTGTTTAAAGGG + Intergenic
1094648354 12:32349855-32349877 CTTTGATTTCTCTGTCAAAATGG + Intronic
1095467396 12:42502082-42502104 GTTTGTGTTTTGTCTCAGAAGGG + Intronic
1098859473 12:75691086-75691108 ATTTGGGTTTTTTGTCTAATGGG + Intergenic
1099337612 12:81383621-81383643 ATTTTGGTTTTGTGTCATGAAGG - Intronic
1099348055 12:81527544-81527566 TTTTGAGTTTTATGTCCAAATGG + Intronic
1101420466 12:104546561-104546583 CTCTGGGTTTTGCTTCAATATGG + Intronic
1106656279 13:31750728-31750750 CATTGGATTTAGTGTCAAAATGG + Intronic
1108249995 13:48555415-48555437 CTTTGGTTTTAGTGATAAAAAGG - Intergenic
1108530104 13:51320613-51320635 CTTTGGGATGTGTGTAAACAAGG - Intergenic
1109517887 13:63468098-63468120 CTTTGGGTTTTTTTTTTAAAGGG - Intergenic
1111027173 13:82543329-82543351 TTTTGTGTTTTGTATCAAAATGG + Intergenic
1117002632 14:51386497-51386519 GTTTGGGTTTTCTGACAAGATGG - Intergenic
1117333785 14:54739214-54739236 TTTTGGCTTTTGTCCCAAAATGG - Intronic
1119295660 14:73531033-73531055 CTTTGGATTAGGTGTCAAAAGGG - Intronic
1119299306 14:73558750-73558772 CTTTGGATTAGGTGTCAAAAGGG - Exonic
1119316661 14:73701901-73701923 TTTTGTGATTTGTTTCAAAATGG + Exonic
1119924950 14:78484654-78484676 GTTTGGGTTTAGGGTCATAATGG + Intronic
1120864104 14:89280866-89280888 CTTTGTGCTTGGTGTCAAATAGG - Intronic
1121704319 14:95980061-95980083 CCGTGGGGTTTGTGTTAAAATGG - Intergenic
1122513731 14:102291158-102291180 CTTCCGGTTTTTTGTCAGAAGGG - Intronic
1122634686 14:103124436-103124458 CTCTGGGTTTCGTGTCACAGAGG + Intronic
1122741466 14:103873959-103873981 CTTGGGGGTTTGTGTGACAAGGG - Intergenic
1123727550 15:23119501-23119523 ATTTGAGTTTAGAGTCAAAAGGG + Intergenic
1124531485 15:30511927-30511949 ATTTGAGTTTAGAGTCAAAAGGG + Intergenic
1124767172 15:32495768-32495790 ATTTGAGTTTAGAGTCAAAAGGG - Intergenic
1125180760 15:36879164-36879186 ATTTGGGTTTTCTGTAAGAAGGG + Intergenic
1125382456 15:39101890-39101912 CTTTCAGTTTTGTATAAAAATGG + Intergenic
1126404546 15:48310394-48310416 ACTTGGGTTTTGTGTTTAAAAGG - Intergenic
1127254138 15:57274149-57274171 CTTTCGATTTTGTGTGAAGACGG + Intronic
1130765384 15:86865336-86865358 CGTGGGGCTTTGAGTCAAAATGG - Intronic
1132222883 15:100118078-100118100 TTTGGGCTTTTGTGTCATAAAGG + Intronic
1134425965 16:14145370-14145392 GTTTGGGATTAGTGTCTAAAAGG + Intronic
1134431385 16:14210987-14211009 ATCTGGATTTTGTGTAAAAATGG + Intronic
1137384818 16:48031638-48031660 CTGTGGGTTTTTTCTCAACACGG - Intergenic
1138366003 16:56477910-56477932 TTTTAGGTTTAGTTTCAAAAAGG + Exonic
1140428829 16:74884270-74884292 CTTTGGGTTGTGTTTTAAGAGGG - Intronic
1140984995 16:80149898-80149920 CTTTGGTTTTGGTGACATAAAGG + Intergenic
1141842938 16:86585990-86586012 CTTTTGGTTTCGTGTTCAAACGG - Intergenic
1142659526 17:1418264-1418286 TTTTGGGTTTTGTTTCAGACAGG + Intergenic
1145177054 17:20709630-20709652 CTCTTCCTTTTGTGTCAAAAGGG + Intergenic
1148217602 17:45841855-45841877 GTCTGGGTTTTGTGACAAAGTGG + Intergenic
1150607290 17:66705065-66705087 TTTTTTGTTTTGTGTCTAAAAGG - Intronic
1150886863 17:69097218-69097240 TTTTGTGTTTTTAGTCAAAATGG - Intronic
1151036581 17:70807641-70807663 CTTTGGGTTTTGGGAAAAGATGG + Intergenic
1151164148 17:72189842-72189864 CTTTGTGTTTTGTTTGAATAAGG - Intergenic
1156511539 18:37641034-37641056 GTCTGGGTTTGGTGTCTAAAAGG + Intergenic
1159586424 18:70288000-70288022 CTTTCGGTTTTCTTTTAAAAAGG + Intergenic
1161367731 19:3890600-3890622 CCTTGGTTTTTGTCTCAAGAAGG - Intronic
1161708784 19:5835380-5835402 CTTTGGGGTCTGGATCAAAATGG - Intronic
1163789472 19:19297994-19298016 CTTTGGGGTCTATGCCAAAAGGG + Intronic
1166813229 19:45526572-45526594 ATTTGGGTTTTGGGGGAAAAGGG + Exonic
1168364823 19:55777307-55777329 CTTTGAGTTGAGTGGCAAAAGGG - Intergenic
926403000 2:12518885-12518907 CTTATGGATTTGGGTCAAAAGGG - Intergenic
926432283 2:12800349-12800371 TTTTGGGTATTGTGTAAGAAAGG - Intergenic
926880815 2:17541723-17541745 TTTTGTGTTTTGAGTTAAAATGG + Intronic
928442665 2:31305039-31305061 CTTTGGGTTTTTTGTGCCAAGGG + Intergenic
928521861 2:32096946-32096968 CTTTGTGTTTTGTGCCAAAAAGG + Intronic
930565676 2:53017218-53017240 CTTTGGGTTTTTTCTCTTAAAGG - Intergenic
931592145 2:63896320-63896342 TTTTTGGTTGTTTGTCAAAAGGG + Intronic
931624824 2:64247779-64247801 CTGTGAGTTTTATGTCAACAGGG + Intergenic
932364287 2:71138120-71138142 ATTTGAGTTTGGAGTCAAAAGGG + Intronic
937041499 2:118824215-118824237 CATTGGGTTTTATTTCAAAATGG - Intergenic
937973986 2:127570025-127570047 CCTTGTGTTTTGTGTCCCAAGGG - Intronic
938179832 2:129170394-129170416 TTTTGAGTTTTGAGGCAAAATGG + Intergenic
939468653 2:142591217-142591239 CTTGGTGATTTGTGACAAAATGG + Intergenic
942284394 2:174400206-174400228 CTTTGCAGTTTGTGTCAAAATGG + Intronic
944360021 2:198842875-198842897 CTTTAGATTTTGTGTGAAGATGG - Intergenic
945515379 2:210757894-210757916 CTTTAGGTTCTGTGTTTAAAAGG - Intergenic
945688191 2:212998230-212998252 CCTTGGGTATTGTGCCAAACAGG + Intergenic
946736208 2:222756937-222756959 CTTTTGGTTTTGTGTGTGAATGG - Intergenic
947170428 2:227305347-227305369 CTATGGGTGTTCTTTCAAAAAGG + Intronic
947485094 2:230540708-230540730 CTTTGGCTATTGAGTCCAAATGG + Intronic
1173164945 20:40681368-40681390 CTTTCGTATTTGTATCAAAAAGG - Intergenic
1177804947 21:25866031-25866053 CACTGGGTTGTGTATCAAAAGGG + Intergenic
1179245437 21:39630057-39630079 TTTTGGTTTTTGTGGGAAAACGG + Intronic
1179992405 21:44954872-44954894 CTTTGGGTTTTTCTTTAAAATGG + Intronic
1180569111 22:16699323-16699345 CTTGGGGTTCTGTGCCAAAAGGG - Intergenic
1180961070 22:19762608-19762630 CTTGGGGTTATGTGTCTTAAGGG + Intronic
1181859035 22:25804233-25804255 GGCTGGGTTTTGTGTGAAAAGGG - Intronic
1182154644 22:28058740-28058762 CTTTGAGTTTGCTGTTAAAAAGG + Intronic
1182727566 22:32460186-32460208 CTTGGGCTTTTGTGTGAAATGGG + Intronic
1183577641 22:38701824-38701846 TTTTGGGTTTTCTGTAAAACTGG + Intergenic
1183758166 22:39790221-39790243 CTTTGGCTTTTATGTGAAGAGGG + Intronic
1185197388 22:49480630-49480652 CTTTGGGTTTTGTGTCAAAAGGG - Intronic
951144743 3:19213939-19213961 CTCTGGTTTCTGTGTCAAGAAGG - Intronic
951654174 3:24986498-24986520 CTTTGGGATTAATGTCCAAATGG + Intergenic
951685760 3:25342529-25342551 CTTTTGCTTTTCTGTTAAAAAGG + Intronic
951696634 3:25451708-25451730 CTTTTGGTTTTCTGTCAGACTGG + Intronic
955611698 3:60764348-60764370 CTTTGGGCTTTGTTTCTGAAAGG - Intronic
955813283 3:62814926-62814948 CTGTGAAGTTTGTGTCAAAATGG - Intronic
956560209 3:70566637-70566659 CTCTGTTTCTTGTGTCAAAATGG + Intergenic
956898338 3:73686791-73686813 CCTTGGGTCTTGTGTAAAGAAGG + Intergenic
956909077 3:73798221-73798243 CATTGAATTTTGTATCAAAAAGG - Intergenic
957602938 3:82361291-82361313 CTTTGGGATTTGAGGCAACATGG + Intergenic
958842137 3:99218932-99218954 CTTTGAATTTTGTGTCTGAAAGG - Intergenic
959932964 3:112002770-112002792 CTTTGTGTTCTTTGTAAAAAGGG - Intronic
960398910 3:117171926-117171948 CTTTGGGTTGTATGTAGAAAGGG - Intergenic
960644844 3:119868044-119868066 CTTTTGGTTTTGTTTTTAAAGGG - Intronic
962032262 3:131613633-131613655 CTTTGGCATGTGAGTCAAAAGGG + Intronic
962603575 3:137013399-137013421 CTTTGCTTTCTGTCTCAAAAAGG - Intergenic
966464785 3:180218354-180218376 CTTTGGGTTCTTTTTCATAAGGG - Intergenic
966970357 3:185039983-185040005 CTTTGGGCATTGTTTCAACATGG + Intronic
967588021 3:191237970-191237992 CTTTGGGATTTTTGTCAAGAAGG - Intronic
969762332 4:9197725-9197747 CTCTGGGTTTTCTGTCAGAAAGG - Intergenic
969957628 4:10907996-10908018 CTTTGGACTTGGTGTTAAAATGG + Intergenic
971147941 4:23999669-23999691 CTTTGGGCTGAATGTCAAAATGG + Intergenic
972141642 4:35968002-35968024 CTTAGGTTTTGCTGTCAAAAAGG + Intronic
972228410 4:37042065-37042087 CTTTGGGCTTTTTCTTAAAAGGG - Intergenic
973901392 4:55476334-55476356 CTTTGGTCATTGTGTCAAATAGG - Intronic
975217599 4:71774124-71774146 CTCTGGGTTTAGTATTAAAAGGG - Intronic
975411616 4:74058528-74058550 CTTTAGTTTCTGTGTGAAAATGG + Intergenic
977378003 4:96233371-96233393 CTTTTGGTGTTGTATCTAAAAGG - Intergenic
978178342 4:105762033-105762055 CTTTGGCTTTGTTGTCAAATTGG + Intronic
979472316 4:121113988-121114010 CTTTTGATTTTTAGTCAAAATGG + Intergenic
982809869 4:159811729-159811751 CTTTGGGGTTTGTCTTAACAGGG - Intergenic
982990929 4:162272875-162272897 CTTAGAGTTGTGTGTCTAAATGG + Intergenic
983139707 4:164135195-164135217 CTGTGGGTTGTGTTTCCAAATGG - Intronic
985262556 4:188128438-188128460 CCTTGAGTTTTGTGACCAAAAGG - Intergenic
986458926 5:7949496-7949518 CTGTGATTTTGGTGTCAAAAGGG - Intergenic
986631708 5:9780363-9780385 CTCTGGATTTTGTGACACAAAGG - Intergenic
986942159 5:12966931-12966953 CTTTGGGTGATGTGTCAATTTGG - Intergenic
987201030 5:15578450-15578472 CTTGTGGTTTTGTATCAAACTGG + Intronic
990106964 5:52276650-52276672 CTTTGGGCTTTGTGTCCACTTGG + Intergenic
990528881 5:56654523-56654545 ATTTGGGTATAGTTTCAAAAAGG + Intergenic
994436449 5:99740546-99740568 TTTTGACTTTTGTGACAAAATGG - Intergenic
995653136 5:114394542-114394564 CTCTGGAGTTTGTGTCAAAAAGG + Intronic
996757091 5:126946621-126946643 CTTTGGGTTTCCAGTAAAAATGG + Intronic
1001117186 5:168949541-168949563 CTTTGGGTCTTTTGTCTACATGG - Intronic
1002492887 5:179591948-179591970 GTTTGGGTTTTTTTTCAAGACGG + Intronic
1003123209 6:3334989-3335011 CTTTTGGGTTTTTGTAAAAATGG + Intronic
1003288296 6:4754499-4754521 ATTTGGGTTTTGTGACAATTTGG + Intronic
1003348708 6:5295401-5295423 CTTAGGTGTTTGAGTCAAAAGGG + Intronic
1004743590 6:18487996-18488018 CTGTGGGTTTTGTTTCAAACAGG - Intergenic
1005830544 6:29667698-29667720 CTTTTGGTTTTTTGGCATAACGG + Intronic
1005901953 6:30224355-30224377 CTTTGGGGTCTCTGTCATAAGGG - Intergenic
1008880927 6:56379276-56379298 TTTTGGGTTCTGTGTCTGAAAGG - Intronic
1008900964 6:56615684-56615706 CTTTGAGTTTTGTGGCAATGAGG + Intronic
1010668869 6:78662739-78662761 TTTTGAGTTTTGTGAGAAAAAGG + Intergenic
1010738366 6:79468795-79468817 CTTTGGGTCATGTGTCAATGAGG + Intergenic
1012390048 6:98728302-98728324 CTTTGGGTTTTTTTTAGAAATGG + Intergenic
1014211478 6:118712790-118712812 GTTCGGGTGTTGTGCCAAAATGG + Intergenic
1015732505 6:136362729-136362751 CTTTGGATTTTGTTTCCAACTGG - Intronic
1017037541 6:150280035-150280057 CTTTTGATTTTTGGTCAAAAGGG - Intergenic
1018097607 6:160404995-160405017 CTTTTGGTGTTGTATCTAAAAGG - Intronic
1018254353 6:161903661-161903683 CTTTGGATTTGTGGTCAAAAGGG + Intronic
1018526179 6:164712154-164712176 CTTGGGGTTTTGTGTTTAAATGG - Intergenic
1018888356 6:167961596-167961618 CTTTCTGTGTTGTTTCAAAAAGG + Intronic
1019275774 7:174750-174772 CCTGGGGTTTTCTGACAAAAGGG + Intergenic
1021469372 7:20983983-20984005 CTTTGAGTTTTCTGGCCAAAAGG - Intergenic
1021771494 7:24006439-24006461 GTTTGAGGTTTGTATCAAAAAGG - Intergenic
1025164286 7:56697405-56697427 CTTTAACTTTTGTGTCAAAAAGG - Intergenic
1025705994 7:63864643-63864665 CTTTAACTTTTGTGTCAAAAAGG + Intergenic
1027142388 7:75668161-75668183 CTTTTGGTTTGGTGCCAAAAAGG - Intronic
1027952494 7:84835513-84835535 CTTTGGCTTTTGGGTAAAATTGG - Intergenic
1028327758 7:89547885-89547907 CTTTGGGTTTTGTTGGAGAAAGG + Intergenic
1030471657 7:109971548-109971570 CTTTGTGATTTGTGACAACATGG + Intergenic
1031575430 7:123410245-123410267 TTTTGGGTTTTGGATCAAATAGG + Intergenic
1031873699 7:127114252-127114274 CTTTGGGTTTTGATGCACAATGG + Intronic
1034526377 7:151666003-151666025 CTTTGGGTTGTTTTTAAAAATGG - Intronic
1035004660 7:155646430-155646452 CTTTGGCACTTGTGACAAAATGG - Intronic
1035365281 7:158345306-158345328 CTTTGGGTTTTGTCTTAATTTGG + Intronic
1035797644 8:2374084-2374106 CTTTGGCTTCTCTGTTAAAATGG - Intergenic
1036272417 8:7319471-7319493 CTCTGGGTTTTCTGTCAGAAAGG - Intergenic
1036348931 8:7990869-7990891 CTCTGGGTTTTCTGTCAGAAAGG + Intergenic
1036844192 8:12151346-12151368 CTCTGGGTTTTCTGTCAGAAAGG + Intergenic
1036865566 8:12393667-12393689 CTCTGGGTTTTCTGTCAGAAAGG + Intergenic
1037677474 8:21064203-21064225 CTATGGATCTTGTGTCAAACAGG - Intergenic
1038886491 8:31668453-31668475 CTTTATATTGTGTGTCAAAATGG + Intronic
1039380495 8:37080401-37080423 CTTTGACTTTTATATCAAAATGG - Intergenic
1043219889 8:77647756-77647778 TTTTGGTTTATATGTCAAAAAGG + Intergenic
1043474450 8:80592681-80592703 CCTTGGCTTTTGTGTCCATAAGG + Intergenic
1043702354 8:83304993-83305015 CTTTGGGTGCTGTGTTGAAAGGG - Intergenic
1044066387 8:87704701-87704723 TTTTGGGTTCTCTGTCTAAAAGG - Intergenic
1044895309 8:96885555-96885577 CCATGGGTTTTGGGCCAAAATGG - Intronic
1046983079 8:120357959-120357981 CTTTGTGTTTGGTTTGAAAATGG - Intronic
1048530765 8:135247673-135247695 CTTTTGGAATTGTGTCAATAGGG + Intergenic
1048539318 8:135328043-135328065 CTTTGGGTATTCTGTGGAAAAGG + Intergenic
1048638390 8:136325301-136325323 ATTTGAGTTTTGTTTCCAAAAGG - Intergenic
1050555658 9:6787733-6787755 TTCTGGCTCTTGTGTCAAAAAGG - Intronic
1050727386 9:8667035-8667057 CTTCTGGTTTTGTTTCAAACTGG - Intronic
1050847379 9:10239076-10239098 CTTTGTGTTTTATGTAAAACAGG - Intronic
1051016291 9:12479223-12479245 CTTTAGGTTTTACGTCATAATGG - Intergenic
1051885074 9:21883938-21883960 CTTTGGTTTTTATGTCCAGAGGG + Intronic
1052157281 9:25207919-25207941 CTTTGGCATTTGTGTACAAAAGG + Intergenic
1052552206 9:29966646-29966668 ATTTGAGTTTTCTCTCAAAATGG - Intergenic
1058989174 9:110238644-110238666 ATTTGGTTTTTGTGTTAAAATGG + Intergenic
1059951463 9:119466709-119466731 CTTTGTGTTCTGGGGCAAAAAGG + Intergenic
1061628120 9:131854244-131854266 CCTTGGGTTTTATGTTACAAGGG - Intergenic
1061753488 9:132797043-132797065 GTTTGGGTTTTGGCTCAAAGTGG - Intronic
1186241190 X:7568546-7568568 CTGTGACTTTTGTGTTAAAATGG - Intergenic
1187548080 X:20272447-20272469 CTTGGGTTTTTGCTTCAAAATGG - Intergenic
1187578460 X:20582847-20582869 CTCTGGATTTGGTGTCATAAAGG + Intergenic
1187879952 X:23837559-23837581 TTTTTGGTTTTTTGACAAAATGG - Intronic
1188085652 X:25898582-25898604 CCGTGGGTTTTGTGTCTTAAGGG - Intergenic
1188290778 X:28385701-28385723 CTTTGGTTATTGTGTCACATAGG + Intergenic
1189448100 X:41100044-41100066 GTCTGGGTTTTGCATCAAAATGG - Intronic
1190304743 X:49075594-49075616 CCTTGGATTGTGTGTCAAAGAGG + Exonic
1190399461 X:50017523-50017545 CTTTTGGTGTTGTATCTAAAAGG + Intronic
1192548920 X:72037979-72038001 TTTTGGATTCTGTGTTAAAAAGG - Intergenic
1194820410 X:98499346-98499368 CTGTGGCTTTTGTTTAAAAATGG + Intergenic
1197192074 X:123658815-123658837 CTTTGGGTGATGTGTCAATGTGG + Intronic
1197323865 X:125067733-125067755 GTTTTTGTTTTGTTTCAAAAGGG + Intergenic
1198127367 X:133659247-133659269 ATTTGGGCTTTGTATCCAAATGG - Intronic
1199153981 X:144524810-144524832 CTTTGTGTTATCTGTCTAAATGG + Intergenic
1199242763 X:145567462-145567484 CTATGGGTTATCTGTCCAAAGGG + Intergenic
1199336486 X:146623665-146623687 CATTGGGGTTGGTGGCAAAAAGG - Intergenic
1199588717 X:149444743-149444765 CTATAGGTTTTGTTTCTAAATGG - Intergenic