ID: 1185199559

View in Genome Browser
Species Human (GRCh38)
Location 22:49493398-49493420
Sequence GGGCTTGTCACTTGAGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185199557_1185199559 -4 Left 1185199557 22:49493379-49493401 CCGCAGGGGCAGGAGGAAGGGGC No data
Right 1185199559 22:49493398-49493420 GGGCTTGTCACTTGAGATCAGGG No data
1185199555_1185199559 -3 Left 1185199555 22:49493378-49493400 CCCGCAGGGGCAGGAGGAAGGGG 0: 1
1: 3
2: 6
3: 137
4: 942
Right 1185199559 22:49493398-49493420 GGGCTTGTCACTTGAGATCAGGG No data
1185199551_1185199559 5 Left 1185199551 22:49493370-49493392 CCTTTCTTCCCGCAGGGGCAGGA 0: 1
1: 0
2: 2
3: 17
4: 193
Right 1185199559 22:49493398-49493420 GGGCTTGTCACTTGAGATCAGGG No data
1185199544_1185199559 30 Left 1185199544 22:49493345-49493367 CCTTATTCTCTTGTTACATCAGG 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1185199559 22:49493398-49493420 GGGCTTGTCACTTGAGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185199559 Original CRISPR GGGCTTGTCACTTGAGATCA GGG Intronic
No off target data available for this crispr