ID: 1185200337

View in Genome Browser
Species Human (GRCh38)
Location 22:49498765-49498787
Sequence TTGGCCACCAAGGACTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185200337_1185200344 0 Left 1185200337 22:49498765-49498787 CCAGGGAAGTCCTTGGTGGCCAA No data
Right 1185200344 22:49498788-49498810 TCAGACTGGAACGGAGGGAACGG No data
1185200337_1185200340 -9 Left 1185200337 22:49498765-49498787 CCAGGGAAGTCCTTGGTGGCCAA No data
Right 1185200340 22:49498779-49498801 GGTGGCCAATCAGACTGGAACGG No data
1185200337_1185200341 -6 Left 1185200337 22:49498765-49498787 CCAGGGAAGTCCTTGGTGGCCAA No data
Right 1185200341 22:49498782-49498804 GGCCAATCAGACTGGAACGGAGG No data
1185200337_1185200342 -5 Left 1185200337 22:49498765-49498787 CCAGGGAAGTCCTTGGTGGCCAA No data
Right 1185200342 22:49498783-49498805 GCCAATCAGACTGGAACGGAGGG No data
1185200337_1185200345 3 Left 1185200337 22:49498765-49498787 CCAGGGAAGTCCTTGGTGGCCAA No data
Right 1185200345 22:49498791-49498813 GACTGGAACGGAGGGAACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185200337 Original CRISPR TTGGCCACCAAGGACTTCCC TGG (reversed) Intronic