ID: 1185200341

View in Genome Browser
Species Human (GRCh38)
Location 22:49498782-49498804
Sequence GGCCAATCAGACTGGAACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185200337_1185200341 -6 Left 1185200337 22:49498765-49498787 CCAGGGAAGTCCTTGGTGGCCAA 0: 1
1: 0
2: 0
3: 9
4: 154
Right 1185200341 22:49498782-49498804 GGCCAATCAGACTGGAACGGAGG 0: 1
1: 0
2: 0
3: 5
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185200341 Original CRISPR GGCCAATCAGACTGGAACGG AGG Intronic
900811352 1:4803707-4803729 GGCCAAAAAGGCTGGAAAGGTGG - Intergenic
902732774 1:18380508-18380530 GCCCAATCTGACTGCAAAGGAGG + Intergenic
904402050 1:30263436-30263458 GGCCACTCAGCCTGGAACATGGG - Intergenic
910909011 1:92214390-92214412 GGCCAATGGGCCTGGAACAGAGG + Intergenic
912107953 1:106304379-106304401 GGCCAATCAGACAAGATCCGAGG - Intergenic
914877489 1:151522991-151523013 GGCCAAACAGCCAGGAACTGAGG - Intronic
917463421 1:175252785-175252807 GGCCAATCAGTCATGAAAGGAGG + Intergenic
919055396 1:192564164-192564186 GGCCAATCAAGCTGGAACTATGG + Intergenic
920833188 1:209483597-209483619 AGCCAATCAAACTGCAAAGGAGG - Intergenic
924908958 1:248488609-248488631 GGCCAACCACACTGGAAAGTTGG + Exonic
924915147 1:248559449-248559471 GGCCAACCACACTGGAAGGTTGG - Exonic
1064426741 10:15236167-15236189 GACCAATCAGACTGGATGGCAGG + Intronic
1077265962 11:1650376-1650398 GGCCAAACAGCCTGGCACTGTGG + Intergenic
1079251952 11:18793014-18793036 GGCCAATGTGACTGGAGCGTGGG - Intergenic
1084336436 11:68460643-68460665 GGCCAATGAGCCTGGAGCTGGGG + Intergenic
1085314759 11:75537927-75537949 GGCCAATGTGGCTGGAATGGAGG + Intergenic
1086720459 11:90114734-90114756 GGGCATTCAGATTGGAAAGGAGG + Intergenic
1094168856 12:27469858-27469880 CGCCTATCAGACTGGAAGGAAGG + Intronic
1098867547 12:75780192-75780214 GGCTAATGAGACTGGACAGGAGG + Intergenic
1100005773 12:89893270-89893292 GGTTAATAAGACTGGAACAGAGG + Intergenic
1105760921 13:23513794-23513816 GGCCAGTCAGAGTAGAAGGGAGG + Intergenic
1105979759 13:25506572-25506594 GGCCAATGAGACGGGAGCTGAGG + Intronic
1106704847 13:32269401-32269423 GGCCAATCAGCCAGGCACAGTGG + Intronic
1108897075 13:55344121-55344143 GGCCAGTAAGACAGGAAAGGAGG + Intergenic
1113286947 13:108860155-108860177 GGCCAAGGAGGCTGGAATGGGGG - Intronic
1118391909 14:65302954-65302976 GTCCAGTCAGACTGAAACTGGGG + Intergenic
1120180614 14:81339064-81339086 GGCCAATTAGGCAGGAAAGGTGG + Intronic
1125330369 15:38575848-38575870 GGCCAATCTGACTGAAAATGTGG - Intergenic
1126252095 15:46579427-46579449 GCCCAAACAGACTGGTATGGGGG - Intergenic
1127295111 15:57602173-57602195 TGCCAACCAGACTGGGACGGGGG + Intronic
1128299677 15:66558084-66558106 GGCCACTCAGATTGAAAGGGAGG - Intronic
1130420933 15:83746260-83746282 GGCCACTCAGACTGCAAGGGAGG - Intronic
1130420943 15:83746325-83746347 GGCCACTCAGAGTGCAAGGGAGG + Intronic
1133722712 16:8509789-8509811 GGCCAATAAGACTGAAGTGGTGG - Intergenic
1136125796 16:28179471-28179493 GTCAAACCAGACTGGAACTGAGG + Intronic
1137593178 16:49706379-49706401 GGCCAATCAGACAGACACGCTGG + Intronic
1140695408 16:77527773-77527795 GGGCAATCAAACTGGAACTCAGG + Intergenic
1141249208 16:82339544-82339566 GGGCAATGAGACTCGAAGGGAGG - Intergenic
1144673622 17:17146955-17146977 GGCCCATCAGAACGGAAAGGTGG - Intronic
1146214863 17:30971096-30971118 GGCCAGCCACACGGGAACGGCGG - Exonic
1146780657 17:35668674-35668696 GGCCAGTTAGACTGGAACACAGG - Intronic
1148553794 17:48565817-48565839 GGCCAGTCAGAGGGGAAGGGAGG - Intronic
1151451121 17:74198941-74198963 GGCCAGGCAGACTGGAACAGGGG - Intergenic
1162519974 19:11173997-11174019 CCCCCATCAGACTGGAAGGGTGG + Intronic
1162782579 19:13014215-13014237 TGCGAATCAGACCGGAGCGGAGG - Intronic
1165257375 19:34587492-34587514 GGGCATCCAGACTGGAAAGGAGG - Intergenic
1166157391 19:40924254-40924276 GGGCAGTCAGACTGGAACCATGG + Intergenic
928681222 2:33704349-33704371 GGAGCATCAGGCTGGAACGGAGG - Intergenic
930277637 2:49332066-49332088 GGCCAATAAGACTGGAGTTGAGG - Intergenic
937458881 2:122068424-122068446 GGCCAGTGAGACTGGGAGGGAGG - Intergenic
939095676 2:137830756-137830778 GGTCAATCAGGCTGGAAAGGGGG + Intergenic
1184641600 22:45875501-45875523 GGAAATTCAGACTGGAAAGGAGG + Intergenic
1185200341 22:49498782-49498804 GGCCAATCAGACTGGAACGGAGG + Intronic
949769473 3:7563678-7563700 GGCCAATGAAACTGGAGTGGAGG + Intronic
950008311 3:9705103-9705125 GGCCATTCAGAATGGGAGGGAGG - Intronic
954718022 3:52536543-52536565 CGCCAATCAGACTGCAGCGGGGG - Intronic
956711742 3:72044272-72044294 GTCCAATCACACTGGGACAGTGG - Intergenic
960420940 3:117444569-117444591 GGCCATACAGACTGGAAGGATGG + Intergenic
963233393 3:142932121-142932143 GGCCAATGAGACAGGAAGGCAGG - Intergenic
963349989 3:144140032-144140054 GGCCTTTCACACTGGAAGGGAGG + Intergenic
964780524 3:160332222-160332244 GAACATTCAGACTGGAATGGTGG + Intronic
965195264 3:165586949-165586971 GGCCAGCCAGGCTGGAATGGAGG - Intergenic
971238952 4:24869964-24869986 GCCCAGCCAGACTGGAAAGGAGG + Intronic
977616909 4:99097264-99097286 GGGCAATCAAACTAGAACTGAGG - Intergenic
977618920 4:99114993-99115015 GGGCAATCAAACTAGAACTGAGG - Intergenic
982469798 4:155774251-155774273 GGCCAATGTGGCTGGAACAGAGG - Intronic
983538984 4:168888650-168888672 GGCCAATGAGACTGGAGGAGTGG - Intronic
985919026 5:2952904-2952926 GGCCATCCAGACTGAAAAGGAGG - Intergenic
989146781 5:38257948-38257970 GGCCGCTCAGACTGGGACGCCGG - Intergenic
991565252 5:67998160-67998182 GGCCAATCATTTTGGAACAGAGG + Intergenic
1003623193 6:7720460-7720482 GGCCAATGAGGCTAGAACAGAGG - Intergenic
1010917016 6:81632705-81632727 GGCCAATCAGAATGGATCTTAGG + Intronic
1018631907 6:165828991-165829013 GCCCAATCAAAGTGGAATGGAGG - Intronic
1021692374 7:23243076-23243098 GGCCAATGAGACAGGAAATGTGG + Intronic
1031710018 7:125033824-125033846 GGCCATTCAGAATGCAAAGGAGG + Intergenic
1032665546 7:134032637-134032659 GGCCTCTCAGACTGGACCTGGGG + Intronic
1038582578 8:28762303-28762325 AGCCAATCAGAAAGGAAAGGGGG - Intergenic
1039608077 8:38899323-38899345 AGCAAATCCGACTGGAACTGAGG - Intergenic
1040551818 8:48443865-48443887 GGCCTTTCAGACTGGGAGGGTGG + Intergenic
1040909219 8:52501532-52501554 GGCCAGGCTGACTGGAAAGGGGG + Intergenic
1055284469 9:74713491-74713513 GGACAATCAGATTGAAAGGGTGG + Intergenic
1056200552 9:84271709-84271731 GTCAAATCAGACTGCGACGGAGG + Intergenic
1057094801 9:92296051-92296073 GCCCAACCAGACTGAAAGGGAGG - Intergenic
1186507110 X:10102027-10102049 GGCCAGCCAGGCTGGAATGGAGG + Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1196635279 X:117994629-117994651 GCCCAGTGAGACTGGAACAGAGG - Intronic
1198808499 X:140511138-140511160 GGCCACTCAGACGGCAACGCCGG - Intergenic
1201626586 Y:16021761-16021783 GCCCAATCAAACTGGAACTCAGG - Intergenic