ID: 1185202993

View in Genome Browser
Species Human (GRCh38)
Location 22:49519781-49519803
Sequence ACTCGTAGTGGAAGATGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 1, 3: 63, 4: 448}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185202989_1185202993 13 Left 1185202989 22:49519745-49519767 CCCAGTATCCACGGCAGAGAATG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1185202993 22:49519781-49519803 ACTCGTAGTGGAAGATGAACCGG 0: 1
1: 0
2: 1
3: 63
4: 448
1185202990_1185202993 12 Left 1185202990 22:49519746-49519768 CCAGTATCCACGGCAGAGAATGA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1185202993 22:49519781-49519803 ACTCGTAGTGGAAGATGAACCGG 0: 1
1: 0
2: 1
3: 63
4: 448
1185202991_1185202993 5 Left 1185202991 22:49519753-49519775 CCACGGCAGAGAATGAATCAGCA No data
Right 1185202993 22:49519781-49519803 ACTCGTAGTGGAAGATGAACCGG 0: 1
1: 0
2: 1
3: 63
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185202993 Original CRISPR ACTCGTAGTGGAAGATGAAC CGG Intronic
900708139 1:4093551-4093573 ACTGGCTGTGGAAAATGAACAGG - Intergenic
901753181 1:11424550-11424572 ACTCATGGTGGAAGGTGAAGCGG - Intergenic
902064897 1:13676892-13676914 ACTCATGGTGGAAGGTGAAGAGG + Intergenic
903242113 1:21989995-21990017 AATCATGGTGGAAGATGAAGGGG + Intronic
903245623 1:22013182-22013204 AATCATGGTGGAAGATGAAGGGG + Intergenic
904151699 1:28446855-28446877 AATCATGGTGGAAGATGAAGGGG - Intronic
904817100 1:33212178-33212200 ACTCATAGTGGAAGGTGAAGGGG - Intergenic
905119004 1:35667286-35667308 AATGGCAGTGGAAGATGGACTGG + Intergenic
905540122 1:38753982-38754004 ACTTGCAGTGGAAGGTGAAGGGG - Intergenic
906092169 1:43189784-43189806 AATCATAGTGGAAGATGAAGGGG + Intronic
907448013 1:54521752-54521774 AATCATGGTGGAAGATGAAAGGG + Intergenic
908043053 1:60135874-60135896 ACTCATGGTGGAAGGTGAAAGGG - Intergenic
909060274 1:70871195-70871217 ACTCATGGTGGAAGATGAAGTGG + Intronic
909418021 1:75429664-75429686 AGTCATGGTGGAAGATGAAGGGG + Intronic
909769018 1:79397103-79397125 AATCATGGTGGAAGATGAAGGGG + Intergenic
910035639 1:82784301-82784323 AATCATGGTGGAAGATGAAGGGG + Intergenic
910044834 1:82900280-82900302 ACTGTAAGTGGAAGAGGAACAGG + Intergenic
910178765 1:84459002-84459024 ACTCATAGTAGAAGGTGAAGGGG + Intergenic
911011017 1:93281038-93281060 AATCGTGGTGGAAGGTGAATGGG + Intergenic
911222603 1:95264917-95264939 AATCATAGTGGAAGGTGAAGAGG + Intergenic
911985320 1:104615696-104615718 AATCAGAGTGGAAGATGAAGGGG + Intergenic
913076680 1:115346027-115346049 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
915257175 1:154642743-154642765 TCTCATGGTGGAAGATGAAAGGG + Intergenic
916400892 1:164447652-164447674 AATCATGGTGGAAGGTGAACGGG + Intergenic
916401140 1:164449728-164449750 ACTCATGCTGGAAGATGAAGAGG + Intergenic
916884935 1:169058166-169058188 ACTCATGGTGGAAAATGAAAGGG - Intergenic
916899652 1:169207133-169207155 ACTCATGGTGGAAGGTGAAGGGG + Intronic
916998993 1:170334690-170334712 ACTCATGGTGGAAGCTGAAGTGG - Intergenic
917408616 1:174735759-174735781 AATCATAGTGGAAGGTGAAGAGG + Intronic
918364050 1:183787899-183787921 ACTCATAGTGGAAGGTGAAGGGG - Intronic
918823527 1:189291427-189291449 AGTCATGGTGGAAGATGAAGGGG + Intergenic
919334021 1:196209155-196209177 AATCGTGGTGGAAGGTGAAGGGG + Intergenic
920998517 1:211018095-211018117 ACTCATGGTGGAAGGTGAAGGGG - Intronic
921498674 1:215872897-215872919 ACCCGTGGTGGAAGGTGAAAAGG - Intronic
921510481 1:216022076-216022098 ACTCATGGTGGAAGGTGAAGGGG - Intronic
921897398 1:220414669-220414691 ACTCATGGTGGAAGGTGAAGAGG - Intergenic
922356285 1:224779477-224779499 AATCATAGTGGAAGATGAAGGGG + Intergenic
922358833 1:224802308-224802330 ACTCATGGTGGAAGGTGAAGAGG - Intergenic
922646894 1:227296219-227296241 CATCGTTGTGGAAGATCAACTGG - Intronic
922812953 1:228428221-228428243 ATTCATGGTGGAAGATGAAGGGG + Intergenic
922872708 1:228916158-228916180 AGTCATGGTGGAAGGTGAACAGG - Intergenic
923920272 1:238556234-238556256 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
924015828 1:239721297-239721319 ACTCCTAATGTAAGGTGAACTGG - Intronic
924793219 1:247272247-247272269 AGTCATGGTGGAAGATGAAGGGG + Intergenic
1063770252 10:9189367-9189389 ACTCTTGGTGGAAGAGGAACGGG - Intergenic
1064335193 10:14434054-14434076 ACTTGTGGTGGAAGGTGAAGGGG - Intronic
1065086210 10:22180063-22180085 ACTCGTAGTGGAAGGTGAAGGGG - Intergenic
1065148295 10:22795494-22795516 ACTCATGGTGGAAGATGAAGCGG - Intergenic
1065733130 10:28727585-28727607 AATCGTGGTGGAAGGTGAAGGGG - Intergenic
1065863070 10:29887697-29887719 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1066473930 10:35726051-35726073 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1067273229 10:44810587-44810609 ACTCATTGTGGAAGGTGAAGGGG - Intergenic
1067559073 10:47292022-47292044 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1067742867 10:48909581-48909603 ACTCATGGTGGAAGGTGAAGGGG + Exonic
1067782962 10:49222350-49222372 ACTCATGGTGGAAGCTGAAGTGG + Intergenic
1068040583 10:51819163-51819185 CCTCGTGGTGGAAGGTGAAGGGG + Intronic
1069323639 10:67204421-67204443 AATCGTGGTGGAAGGTGAAGGGG - Intronic
1069422953 10:68262906-68262928 AATCATAGTGGAAGGTGAAGAGG - Intergenic
1070716263 10:78724280-78724302 ACTCTTGGTGGAAGATGAAGTGG + Intergenic
1071279745 10:84089859-84089881 ACTCATGGTGGAAGGTGAAACGG - Intergenic
1071507169 10:86239734-86239756 AATCGTGGTGGAAGGTGAAAGGG - Intronic
1072263664 10:93706486-93706508 AATCGTAGTGGAAGGTGAAGAGG - Intergenic
1073744003 10:106445154-106445176 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1073833712 10:107416450-107416472 ACTCATATAGGAAGGTGAACAGG + Intergenic
1076460270 10:130639072-130639094 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1078494422 11:11801704-11801726 ACTCTTTGTGGAAGAAGAACAGG + Intergenic
1080480733 11:32647234-32647256 ACTCATGGTGGAAGGTGAAGTGG + Intronic
1080720673 11:34845347-34845369 ATTCATAGTGGAAGGTGAAGAGG - Intergenic
1081090091 11:38853808-38853830 AATCATGGTGGAAGATGAAAGGG - Intergenic
1081219805 11:40446699-40446721 AATCGTGGTGGAAGGTGAAGGGG + Intronic
1081507753 11:43735819-43735841 AATCATGGTGGAAGATGAAGGGG + Intronic
1081744053 11:45460700-45460722 AATCATAGTGGAAGATGAAGGGG - Intergenic
1082127990 11:48455042-48455064 ACTCGTGGTGGAAGGTGAAGTGG + Intergenic
1082561539 11:54625969-54625991 ACTCATGGTGGAAGGTGAAGTGG + Intergenic
1082705717 11:56492122-56492144 ACTAGAAGTGGAAGATCAAGAGG - Intergenic
1082706770 11:56502028-56502050 ACTAGAAGTGGAAGATCAAGAGG - Intergenic
1082965730 11:58964594-58964616 AGTGGTACTGGGAGATGAACAGG - Intronic
1083255505 11:61493072-61493094 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1083495952 11:63053178-63053200 AATCATAGTGGAAGATGAAGGGG - Intergenic
1084670216 11:70602164-70602186 ACTCATGGTGGAAGGTGAAATGG - Intronic
1085241224 11:75058120-75058142 AATCATAGTGGAAGGTGAAGAGG + Intergenic
1086240246 11:84681947-84681969 ACTCATAGCAGAAGATGAAGGGG + Intronic
1086351458 11:85945972-85945994 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1086537724 11:87868331-87868353 ACTCATGCTGGAAGGTGAACAGG - Intergenic
1086862769 11:91944470-91944492 AGTCGTAGTGGAAAAGGAAGGGG + Intergenic
1087429373 11:98033042-98033064 ACTCATGGTGGAAGGTGAAGTGG - Intergenic
1087497732 11:98911129-98911151 AATCATGGTGGAAGATGAAGGGG - Intergenic
1088740297 11:112761788-112761810 ACTCATGGCGGAAGATGAAGGGG + Intergenic
1089539240 11:119180052-119180074 ACTCATAGTGGAAGAAGAGGTGG - Exonic
1089582097 11:119487856-119487878 AATCGTGGTGGAAGGTGAAGGGG + Intergenic
1090952996 11:131489995-131490017 ACTCATGGTAGAAGATGAAAGGG + Intronic
1091306688 11:134540854-134540876 ACTCGTGGTGGAAGGTGAAGAGG - Intergenic
1091786484 12:3246119-3246141 AGTCATGGTGGAAGATGAAGGGG + Intronic
1093333885 12:17877724-17877746 AATCATAGTGGAAGGTGAAGGGG + Intergenic
1095254661 12:40020440-40020462 AATCATAGTGGAAGGTGAAGGGG - Intronic
1095317622 12:40785331-40785353 ACTCATAGTGGAAGACGAAGTGG + Intronic
1095728910 12:45483578-45483600 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1095769350 12:45935374-45935396 AATGTTAGTGGAAGACGAACAGG + Intronic
1095837013 12:46649689-46649711 ACTCATGGTGGAAGGTGAAAGGG - Intergenic
1095847671 12:46763335-46763357 AATCATAGTGGAAGGTGAAGAGG + Intergenic
1097361327 12:58661693-58661715 ACACATAGTGGAAGATAAAGGGG - Intronic
1097364496 12:58696270-58696292 AATCATAGTGGAAGGTGAAGTGG - Intronic
1097699599 12:62806690-62806712 AGTCGTGGTGGAAGGTGAAGGGG - Intronic
1098120952 12:67237456-67237478 ACTCGTGGTGGAAGACAAAGGGG - Intergenic
1098306677 12:69109399-69109421 TCTCCAAGTAGAAGATGAACGGG - Intergenic
1098325479 12:69297809-69297831 ACTCGTGGTAGAAGGTGAAGTGG - Intergenic
1098761187 12:74427403-74427425 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1099675352 12:85754575-85754597 AATCATAGTGGAAGGTGAAGGGG - Intergenic
1099778498 12:87165014-87165036 AATCGTGGTGGAAGGTGAAGGGG + Intergenic
1099786409 12:87269613-87269635 AATCGTGGTGGAAGAAGAATGGG + Intergenic
1100084099 12:90886469-90886491 AATCATAGTGGAAGGTGAAGGGG - Intergenic
1100286644 12:93173193-93173215 ACTCATGGTGGAACATGAAGGGG + Intergenic
1101021324 12:100557231-100557253 ACTCATGGTGGAAGGTGAAGGGG + Intronic
1104231581 12:126889759-126889781 ACTCGTGGGGGAAGATAAAATGG + Intergenic
1105434832 13:20367505-20367527 ACTCGTGGCAGAAGGTGAACAGG + Intergenic
1106439894 13:29757049-29757071 ACTCATGGTGGAAGGTGAAGTGG - Intergenic
1106653842 13:31721092-31721114 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1106662005 13:31809582-31809604 AGTCATTGTGGAAGATGAAGGGG - Intergenic
1109001203 13:56808222-56808244 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1109977226 13:69854282-69854304 ACTCATTGAGGAAGATGAAGGGG + Intronic
1109978160 13:69870206-69870228 ACTCGTAGTGGAAGTTTAAGGGG + Intronic
1110182658 13:72635933-72635955 ACTCATGGTGGAAGGTGAATGGG - Intergenic
1111207694 13:85034391-85034413 AATCATAGTGGAAGGTGAATAGG - Intergenic
1111241789 13:85483500-85483522 AATCGTAGTGGAAGTTAAAGAGG + Intergenic
1111482447 13:88848769-88848791 ACTCCTTATGGAAGATGAAAAGG + Intergenic
1111656520 13:91160969-91160991 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1111920408 13:94404006-94404028 ACTAGTAATTGAAGATGAAGGGG - Exonic
1112114147 13:96334347-96334369 ACTCATGGTGGAAGGTGAAGTGG - Intronic
1112288251 13:98123047-98123069 ACTCACAGTGGAAGGTGAAGGGG - Intergenic
1112437789 13:99404025-99404047 ACTCCTGGTGGAAGGTGAAGCGG + Intergenic
1112945098 13:104918680-104918702 ACTTGTGGTGGAAGGTGAACTGG - Intergenic
1114576681 14:23720956-23720978 AATTATAGTGGAAGATGAAGGGG + Intergenic
1114935844 14:27535129-27535151 AATCATGGTGGAAGATGAAGGGG - Intergenic
1115006891 14:28496660-28496682 AATCATAGTGGAAGGTGAAGGGG - Intergenic
1115895690 14:38084443-38084465 ACTCATTATGGAAGATGAAGGGG - Intergenic
1116129506 14:40836700-40836722 AGTCATAGTGGAAGATGAAATGG + Intergenic
1118038070 14:61889701-61889723 ACTCAGAGTGGAAGATGAAAGGG - Intergenic
1121870100 14:97399552-97399574 AATCATGGTGGAAGATGAAGGGG + Intergenic
1124507300 15:30289430-30289452 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1124601424 15:31135804-31135826 ACTCATGGTGGAAGAGGAAGAGG - Intronic
1124736255 15:32249229-32249251 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1124889172 15:33716113-33716135 ACTCATAGCAGAAGATGAAGGGG - Intronic
1125287918 15:38114058-38114080 ACTGTTAGTGGAAGATGAATTGG - Intergenic
1125780075 15:42257395-42257417 ACTCATGGTGGAAGGTGAAGGGG - Intronic
1130038022 15:80379183-80379205 ACTCATGGTGGAAGAGGAAGGGG - Exonic
1130141986 15:81235340-81235362 ACTCATGATGGAAGATGAAGAGG + Intronic
1131333715 15:91526665-91526687 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1131506232 15:93022237-93022259 ACTCATGGTGGAAGGTGAAGTGG + Intronic
1131800796 15:96067655-96067677 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1133404806 16:5514974-5514996 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1134560281 16:15203131-15203153 ACTCATGGTGGAAGGTGAAGAGG + Intergenic
1134841867 16:17407995-17408017 ACTCACAGTGGAAGGTGAAGGGG - Intronic
1134920823 16:18114745-18114767 ACTCATGGTGGAAGGTGAAGAGG + Intergenic
1135196064 16:20395856-20395878 ACTCATGGTGGAAGGTGAAGGGG - Intronic
1135647692 16:24177363-24177385 ATTAATAGTGGAAGATGAAAGGG - Intronic
1135673795 16:24396999-24397021 ACTCCTAGTGGAAGGTGAAAGGG + Intergenic
1135876405 16:26204357-26204379 ACTCATAGTGGAAGGTGAAGCGG - Intergenic
1136096064 16:27957843-27957865 ACTCATGGTGGAAGATGTAGAGG + Intronic
1137324511 16:47420713-47420735 ACTTGTGGTGGAAGGTGAAAGGG - Intronic
1137681449 16:50349498-50349520 AATCGTACTGGAACATGAAGGGG - Intronic
1137725886 16:50656324-50656346 ACTTGCAGTGGAAGGTGAAGGGG - Intergenic
1140541079 16:75756974-75756996 AATCATGGTGGAAGGTGAACGGG + Intronic
1146238856 17:31195485-31195507 ATTTGTTTTGGAAGATGAACAGG - Intronic
1146452949 17:32989192-32989214 ACTCATGGTGGAAGGTGAAGGGG - Intronic
1146732506 17:35206083-35206105 ACACATGGTGGAAGATGAAGGGG - Intergenic
1149632140 17:58135120-58135142 AATCATAGTGGAAGGTGAAGTGG + Intergenic
1150335919 17:64330763-64330785 AATCGTAGTGGAAAATGACTAGG - Intronic
1150511259 17:65755235-65755257 AATCGCAGTGGAAGTTGAAGGGG + Intronic
1151432722 17:74075108-74075130 AGTCATGGTGGAAGATGAAGAGG + Intergenic
1152300552 17:79493110-79493132 ACTCATGGTGGAAGCTGAAGAGG + Intronic
1153104791 18:1514004-1514026 AATCGTAGTGGAAGGTGAAGGGG + Intergenic
1153206812 18:2711976-2711998 ACTCATGGTGGAAGGTGAAGGGG - Intronic
1155942991 18:31818518-31818540 AGTCGTGGTGGAAGGTGAAGGGG + Intergenic
1156050956 18:32933464-32933486 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1157432872 18:47644057-47644079 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1157432893 18:47644163-47644185 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1157488188 18:48104345-48104367 ACTCATGGTGGAAGAGGAAGGGG - Intronic
1157768103 18:50318082-50318104 ACTCATGGTGGAAGAGGAAGGGG - Intergenic
1157908365 18:51590960-51590982 ACTCATGGTGGAAGGTGAAAGGG + Intergenic
1158129018 18:54132327-54132349 AATCGTGGTGGAAGGTGAAGGGG - Intergenic
1158517662 18:58144305-58144327 AATCATGGTGGAAGATGAAGGGG + Intronic
1158682910 18:59584709-59584731 ACTTGTGGTGGAAGGTGAAGGGG - Intronic
1158898533 18:61939178-61939200 AGTCCCAGTGGAAGATTAACTGG + Intergenic
1159030855 18:63229628-63229650 ACTCGTAGCAGAAGGTGAAATGG - Intronic
1159695490 18:71552131-71552153 ACTCATGGTGGAAGGTGAAGCGG - Intergenic
1159697146 18:71574682-71574704 AATCATAGTGGAAGACGAAGGGG + Intergenic
1159765447 18:72482646-72482668 AATCATAGTGGAAGATGAAGGGG + Intergenic
1160010304 18:75102306-75102328 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1162637645 19:11982838-11982860 AATCATAGCGGAAGGTGAACGGG + Intergenic
1164309842 19:24035942-24035964 ACTCATGGTGGAAGATGAAGTGG - Intronic
1164801633 19:31081500-31081522 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1164950244 19:32330949-32330971 AATCATGGTGGAAGATGAAGGGG + Intergenic
1165181280 19:33973105-33973127 ACTTGTAGTGGAAGAGGAAGGGG - Intergenic
1165910665 19:39224655-39224677 GCCCGTAGTGGACGATGCACTGG - Intergenic
1167225582 19:48237225-48237247 ACTCATGGTGGAAGGTGAAGTGG + Intronic
925110122 2:1328012-1328034 ACTCATGGTGGAAGGTGAAGGGG + Intronic
925651105 2:6090270-6090292 GATCATAGTGGAAGATGAAGGGG + Intergenic
925775199 2:7328426-7328448 AATCATGGTGGAAGGTGAACAGG - Intergenic
926058134 2:9788408-9788430 AGTCATAGTGGAAGGTGAAGAGG - Intergenic
926449342 2:12983351-12983373 AATCATAGTGGAAGGTGAAGGGG - Intergenic
928571622 2:32615049-32615071 ACTCATGGTGGAAGATGAAGCGG + Intronic
928977655 2:37105488-37105510 ACTCATGGTGGAAGGTGAAGGGG - Exonic
929017538 2:37513846-37513868 AATCATAGTGGAAGGTGAAGGGG + Intergenic
929025016 2:37592116-37592138 ACTCATGATGGAAGATGAAGGGG - Intergenic
930443037 2:51432594-51432616 ACTCGTAGTGGAAGGTAAGGAGG - Intergenic
930479077 2:51924454-51924476 ACTTATGGTGGAAGATGAAGGGG - Intergenic
930727014 2:54692372-54692394 ACTCATGGTGGAAGGTGAAATGG - Intergenic
931135754 2:59398780-59398802 AATCGTGGTGGAAGGTGAAGGGG + Intergenic
932603444 2:73146272-73146294 ACTCATGGTGGAAGGTGAAGCGG - Intronic
932916044 2:75859280-75859302 ACTCATTGTGGAAGGTGAAGAGG + Intergenic
932948934 2:76270304-76270326 ACTCATAGTGGGAGGTGAACAGG - Intergenic
933164795 2:79064180-79064202 AATCATAGTGGAAGGTGAAGGGG - Intergenic
933476562 2:82799051-82799073 AATCATAGGGGAAGATGAAGGGG + Intergenic
933629384 2:84638836-84638858 ACTCATGGTGGAAGGTGAAGTGG + Intronic
934294564 2:91732001-91732023 AATCATGGTGGAAGATGAAGGGG + Intergenic
934702085 2:96450654-96450676 ACTCATAGTGGAAAGTGAAGGGG + Intergenic
934936165 2:98467062-98467084 ACTCGTGGTGGAAGGTGAAGGGG + Intronic
935062532 2:99620895-99620917 ACTCATGGTGGAAGGTGAAGGGG - Intronic
935164462 2:100558039-100558061 ACTCATCGTGGAAGGTGAAGGGG + Intergenic
935833974 2:107029951-107029973 AATCGTGGTAGAAGATGAAGGGG + Intergenic
935870773 2:107446676-107446698 ACTCATAGTGGAAGAGGAAGGGG + Intergenic
936694572 2:114930760-114930782 AATCACAGTGGAAGATGAAATGG + Intronic
937802830 2:126100451-126100473 ACTCATGGTGGAAGGTGAAGAGG - Intergenic
938227543 2:129628657-129628679 ACTCTTGGTGGAAGGTGAAGCGG - Intergenic
939480083 2:142737182-142737204 AATGGTAGTGGAATATGAATTGG + Intergenic
939565608 2:143783372-143783394 AATCATGGTGGAAGATGAAGGGG + Intergenic
939783045 2:146473588-146473610 AATCGTGGTGGAAGGTGAAGGGG - Intergenic
940139044 2:150473121-150473143 ATTAGAAGTGGAAGGTGAACTGG + Intronic
940194696 2:151080635-151080657 ACTCATGGTGGAAGGTGAAGTGG + Intergenic
941492350 2:166158044-166158066 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
941679292 2:168379445-168379467 AATCGTGGTGGAAGGTGAAGGGG + Intergenic
941738520 2:169007525-169007547 ACTCATACTGAAAGATGAAGGGG + Intronic
942108585 2:172657939-172657961 ACTCCTGGTGGAAGGTGAAGGGG + Intergenic
942137391 2:172940529-172940551 ACTCATGGTGGAAGGTGAAGTGG - Intronic
942518950 2:176782839-176782861 ACTCATGGTGGAAGAGGAAGAGG - Intergenic
944679343 2:202062706-202062728 AATCATGGTGGAAGGTGAACGGG - Intergenic
945360428 2:208889773-208889795 ACTCATATTGCAAGATGACCTGG + Intergenic
946734393 2:222740046-222740068 ACTCATAGCGGAAGGTGAAGGGG + Intergenic
946762220 2:223005809-223005831 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
946881945 2:224185340-224185362 ACTCACAGTGGAAAATGAAAGGG + Intergenic
947128574 2:226897585-226897607 ACTCATGGTGGAAGGTGAAGGGG + Intronic
947280704 2:228450777-228450799 AATCATAGTGGAAGGTGAAGGGG - Intergenic
947756506 2:232569743-232569765 ACTCAAAGAGGAAGATGACCTGG - Intronic
948312521 2:236999392-236999414 AATCGTGGTGGAAGGTGAAGCGG - Intergenic
948770041 2:240247125-240247147 AATCGTGGTGGAAGGTGAAGGGG - Intergenic
1169505877 20:6210813-6210835 AATCATGGTGGAAGGTGAACGGG + Intergenic
1169754301 20:9026819-9026841 ACTCTTGGTGGAAGGTGAAGGGG + Intergenic
1170356353 20:15496310-15496332 AGTTGTTGTGGAAGATGAGCGGG + Intronic
1170412708 20:16108017-16108039 ACACCTAGTGGAAGGGGAACTGG + Intergenic
1170814078 20:19698048-19698070 AGTCATGGTGGAAGGTGAACGGG + Intronic
1171054766 20:21895639-21895661 ACTCGTGGTGGAAGGTGATGGGG + Intergenic
1173139375 20:40468757-40468779 ACTCATGGTGGAAGGTGAAAAGG - Intergenic
1174077269 20:47946553-47946575 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1175043198 20:56075762-56075784 AATCATGGTGGAAGATGAAGGGG - Intergenic
1175535440 20:59707801-59707823 ACTCATGGTGGAAGGTGAAGGGG - Intronic
1175880075 20:62252779-62252801 ACTCGTGGTGGAAGGCGAAGCGG + Intronic
1177803101 21:25847681-25847703 AATCATGGTGGAAGATGAAAGGG - Intergenic
1177973857 21:27824087-27824109 ACTCATGGTGGAAAATGAAGTGG - Intergenic
1178387380 21:32163945-32163967 ACTCATGGTGGAAGGTGAACAGG + Intergenic
1178668149 21:34566781-34566803 ACTCATGGTGGAAGGTGAAGGGG + Intronic
1178730224 21:35095184-35095206 ATTCATGGTGGAAGATGAAGCGG + Intronic
1178766047 21:35451879-35451901 ACTCATGGTGGAAGGTGAAGTGG + Intronic
1179620201 21:42609427-42609449 AATCATAGTGGAAGGTGAAGGGG + Intergenic
1179899923 21:44385741-44385763 AATCATGGTGGAAGATGAAGGGG + Intronic
1179932066 21:44577439-44577461 ACTCATGGTGGAAGGTGGACGGG + Intronic
1180003353 21:45005173-45005195 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1180942557 22:19668882-19668904 AGTCTTTGTGGAAGGTGAACGGG + Intergenic
1182832650 22:33316143-33316165 ACTCGTAGTGCAGGAAGTACAGG + Exonic
1184319449 22:43729035-43729057 ACTGGTGGTGGAAGGTGAACAGG + Intronic
1184365294 22:44047242-44047264 CCTCATAGTGGAAGGTGAAGAGG + Intronic
1184800651 22:46756837-46756859 ACTCATGGTGGAAGGTGAAGCGG + Intergenic
1184946103 22:47805223-47805245 AATCATGGTGGAAGATGAAGGGG + Intergenic
1185202993 22:49519781-49519803 ACTCGTAGTGGAAGATGAACCGG + Intronic
949113552 3:292722-292744 ACTCATGGTGGAAGGTGAAGCGG + Intronic
949276420 3:2288297-2288319 ACTCATTGTGGAAGGTGAAGGGG + Intronic
949371109 3:3335579-3335601 CCTCGTGGTAGAAGATGAAGTGG - Intergenic
951425785 3:22543547-22543569 AATCATAGTGGAAGGTGAAGGGG - Intergenic
951428767 3:22581915-22581937 ATTCTTAGTGGAGGCTGAACTGG + Intergenic
952221243 3:31326379-31326401 AATCATGGTGGAAGATGAAGGGG + Intergenic
952253302 3:31674695-31674717 ACTCGTGGTGGAAGAGGAAGGGG - Intronic
952611361 3:35214703-35214725 AATCATGGTGGAAGATGAAGGGG + Intergenic
953428211 3:42813458-42813480 AATCATGGTGGAAGATGAAGGGG + Intronic
953542147 3:43830315-43830337 AATCGTGGTGGAAGGTGAAGGGG + Intergenic
953625008 3:44563498-44563520 AATCATAGTGGAAGTTGAAGAGG + Intronic
955141996 3:56278727-56278749 ACTCCTGGTGGAAGAGGAAGGGG + Intronic
955551309 3:60088050-60088072 ACTCATGGTGGAAGATGAAAGGG + Intronic
956238442 3:67102909-67102931 ACTCATAGTAGAAGGTGAAGGGG - Intergenic
957293550 3:78307581-78307603 AATCATAGTGGAAGGTGAAGAGG - Intergenic
958197406 3:90258883-90258905 ACTGGTAGTGGAGCATAAACTGG + Intergenic
958256447 3:91331118-91331140 AATCATAGTGGAAGGTGAAGGGG - Intergenic
958420849 3:93928987-93929009 ACTGGTAGTGGAGCATAAACTGG + Intronic
958736606 3:98016412-98016434 ACTCATGGTGGAAGGTGAACGGG - Intronic
960542115 3:118872350-118872372 AATCATGGTGGAAGATGAAGGGG - Intergenic
960650052 3:119937413-119937435 ACTTGTGGTGGAAGGTGAAGGGG - Intronic
961382516 3:126505091-126505113 ACTCATGGTGGAAGGTGAAGGGG - Intronic
962657692 3:137565445-137565467 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
962712491 3:138099782-138099804 ACTCCTGGTGGAAGGTGAAGGGG - Intronic
963267188 3:143251262-143251284 AATCGTGGTGGAAGGTGAAGGGG + Intergenic
963427851 3:145155164-145155186 ACTCATAGTGGAAGGTGAAGTGG + Intergenic
964852687 3:161111977-161111999 AATCATGGTGGAAGAGGAACGGG - Intronic
965387070 3:168057467-168057489 AATCATGGTGGAAGATGAAGGGG + Intronic
965979799 3:174674110-174674132 ACTCATAGTGGAAGGAGAAGAGG + Intronic
966760818 3:183417815-183417837 AATCATGGTGGAAGATGAAAGGG + Intronic
966767003 3:183472436-183472458 ACTCATGGTGGAAGGTGAAGCGG - Intergenic
967504947 3:190243539-190243561 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
967523885 3:190469919-190469941 AATCGTGGTGGAAGGTGAAGGGG - Intergenic
967651936 3:191996406-191996428 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
967883787 3:194319721-194319743 ACTCATGGTGGAAGAAGAAAGGG + Intergenic
969951659 4:10843253-10843275 ACTCATAGTGGAAGGTGAAGTGG + Intergenic
970235893 4:13957693-13957715 ACTCGTGGTGGCAGGTGAAGGGG - Intergenic
970359352 4:15292908-15292930 AATCATAGTGGAAGATGAAGGGG + Intergenic
970374793 4:15446318-15446340 AATCATGGTGGAAGATGAAGAGG + Intergenic
971102106 4:23478597-23478619 ACTCATGGTGGAAGGTGAAGAGG + Intergenic
971175792 4:24281363-24281385 ACTCACAGTGGAAGATGAAGAGG + Intergenic
971716058 4:30178798-30178820 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
971969707 4:33605663-33605685 AATCATAGTGGAAGGTGAAGAGG + Intergenic
972878299 4:43393227-43393249 ACTCATGGTGGAAGATGTAGGGG + Intergenic
974136699 4:57827079-57827101 AATCATAGTGGAAGGTGAAGTGG + Intergenic
974349359 4:60724488-60724510 ACTCATGGTGGAAGGTGTACGGG - Intergenic
974799686 4:66801287-66801309 AGTCATGGTGGAAGATGAAGGGG + Intergenic
975907471 4:79231315-79231337 ACTGCTAGTGGAAGAGGTACTGG + Intronic
976821207 4:89209052-89209074 ACTCATGGTGGAAGGTGAAGTGG + Intergenic
976936412 4:90640803-90640825 AGTCATGGTGGAAGATGAAAGGG - Intronic
977082434 4:92548805-92548827 ATTCGTGGTGGAAGGTGAATGGG + Intronic
977365840 4:96067462-96067484 AATCATAGTGGAAGGTGAAGGGG + Intergenic
977854664 4:101875441-101875463 AATCATGGTGGAAGATGAAGGGG + Intronic
978100786 4:104838994-104839016 ACTCATGGTGGAAGGTGAAGTGG - Intergenic
978591440 4:110328863-110328885 AATCATGGTGGAAGATGAAGGGG - Intergenic
979180456 4:117720496-117720518 AGTCATAGTGGAAGGTGAAAGGG - Intergenic
979858866 4:125668197-125668219 ACTCATGGTGGAAGGTGAAGAGG - Intergenic
979876701 4:125900630-125900652 AGTCGTGGTGGAAGGTGAACGGG + Intergenic
980153941 4:129081500-129081522 AATCATGGTGGAAGATGAAGGGG + Intronic
980219530 4:129898033-129898055 ACTCATGGCAGAAGATGAACAGG + Intergenic
981293903 4:143107865-143107887 ACTAAAAGTGGAGGATGAACAGG + Intergenic
981330361 4:143501254-143501276 AATCATAGTGGAAGGTGAAGAGG - Intergenic
982162752 4:152586451-152586473 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
982187880 4:152820554-152820576 AGTCGTAGTGGAAGGTGAAGGGG + Intronic
982417676 4:155156301-155156323 AGTCATGGTGGAAGATGAAGGGG - Intergenic
982608328 4:157541022-157541044 AATCATGGTGGAAGATGAAGGGG - Intergenic
982618739 4:157677291-157677313 AATCATGGTGGAAGGTGAACAGG + Intergenic
982871883 4:160589986-160590008 ACTCACAGTGGAAGGTGAAGGGG + Intergenic
984035970 4:174668122-174668144 AATCATAGTGGAAGGTGAAGGGG - Intronic
984276843 4:177621204-177621226 ACTCATAGTGGAAGGCGAAAGGG - Intergenic
985159211 4:187026712-187026734 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
986108968 5:4692411-4692433 ACTCATGGTGGAAGGTGAATGGG + Intergenic
987003927 5:13689556-13689578 AATCATGGTGGAAGATGAAGAGG - Intergenic
987038784 5:14042522-14042544 AATCGTGGTGGAAGATGAAGAGG - Intergenic
987693860 5:21302686-21302708 AATTGTAGTGGAAGGTGAAAGGG - Intergenic
987909513 5:24123388-24123410 AATCATGGTGGAAGATGAATGGG + Intronic
988249310 5:28734742-28734764 GATCATAGTGGAAGATGAAGGGG - Intergenic
988256362 5:28824269-28824291 AATCATTGTGGAAGATGAAGGGG - Intergenic
988425505 5:31058795-31058817 AATCATGGTGGAAGATGAAAGGG - Intergenic
988862294 5:35295048-35295070 ACTTATAGTGGAAGAAGAAGGGG + Intergenic
989150082 5:38290649-38290671 ACTCCAAGTGGAAGAAGAAACGG - Intronic
989499642 5:42150422-42150444 AATCATGGTGGAAGATGAAGGGG - Intergenic
990222349 5:53606320-53606342 ACTCATGGTGGAAGGTGAAGTGG + Intronic
991102236 5:62805381-62805403 ACTCATGGTGGAAGGTGAACAGG - Intergenic
991746396 5:69746855-69746877 AATCGTAGTGGAAGGTGAAAGGG + Intergenic
991751309 5:69808386-69808408 AATCGTAGTGGAAGGTGAAAGGG - Intergenic
991797998 5:70326800-70326822 AATCGTAGTGGAAGGTGAAAGGG + Intergenic
991825774 5:70622169-70622191 AATCGTAGTGGAAGGTGAAAGGG + Intergenic
991830597 5:70683280-70683302 AATCGTAGTGGAAGGTGAAAGGG - Intergenic
991890339 5:71326120-71326142 AATCGTAGTGGAAGGTGAAAGGG + Intergenic
992000378 5:72430417-72430439 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
992644830 5:78802246-78802268 ACGTGTTATGGAAGATGAACAGG - Intronic
992757521 5:79922365-79922387 AATCATGGTGGAAGATGAAGGGG - Intergenic
992875527 5:81050686-81050708 GCTCGTAGAGGAAGAGGACCAGG - Intronic
993346816 5:86794385-86794407 ACTCATGGTGGAAGATGAAGGGG - Intergenic
993882046 5:93374468-93374490 ACTCATGGTGGAAGGTGAAGAGG - Intergenic
994646723 5:102479270-102479292 AATCATAGTGGAAGTTGAAGGGG - Intronic
995608322 5:113881924-113881946 AGTCATGGTGGAAGATGAAGGGG - Intergenic
996892616 5:128440404-128440426 AATCATGGTGGAAGGTGAACAGG + Intronic
996911249 5:128659649-128659671 AGCCATAGTGGAAGGTGAACAGG - Intronic
997246752 5:132356233-132356255 ACTCACAGTGGAAGGTGAAGGGG - Intergenic
997779763 5:136644773-136644795 GCTCATGGTGGAAGATGAAGGGG - Intergenic
997905407 5:137811614-137811636 AGTCATAGTGGAAGGTGAAGGGG - Intergenic
998618936 5:143773144-143773166 AATCATGGTGGAAGGTGAACAGG + Intergenic
1000574920 5:162965785-162965807 AATCATGGTGGAAGATGAAGGGG + Intergenic
1001194743 5:169662600-169662622 AATCATGGTGGAAGATGAAGGGG + Intronic
1001327513 5:170739872-170739894 ACTCATAGTGGAAGGTGAAGGGG - Intergenic
1001719759 5:173847372-173847394 AATCCTGGTGGAAGATGAAGGGG + Intergenic
1001890946 5:175337986-175338008 ACTCATAGTGGAAGATAAAGGGG - Intergenic
1003989238 6:11469446-11469468 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1004088637 6:12476435-12476457 ACTCATGGTGGAAGATGAGGCGG + Intergenic
1004473573 6:15950452-15950474 ACTCATCGTGGAAGGTGAACAGG - Intergenic
1004603317 6:17171464-17171486 ACTCATGGTGGAAGGTGAAGAGG + Intergenic
1005220747 6:23585447-23585469 AGTCATAGTGGAAGGTGAAGGGG - Intergenic
1005222422 6:23601853-23601875 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1005557050 6:26997253-26997275 AATCGTAGTGGAAGGTGAAAGGG + Intergenic
1007083852 6:39128736-39128758 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1008423458 6:51329809-51329831 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1008747223 6:54686799-54686821 ACTCATTGTGGAAGGTGAAGGGG - Intergenic
1008998886 6:57690043-57690065 AATCATAGTGGAAGGTGAAGGGG + Intergenic
1009187373 6:60589422-60589444 AATCATAGTGGAAGGTGAAGGGG + Intergenic
1010010863 6:71046548-71046570 CCTGGTGGTGGAAGAAGAACTGG + Intergenic
1010562358 6:77366245-77366267 AGTCGTGGTGGAAGGTGAAGAGG - Intergenic
1010974766 6:82299305-82299327 ACTCATGGTGGAAGGTGAAAGGG + Intergenic
1011645626 6:89455340-89455362 ACTCATGGTGGAAGGTGAAGGGG + Intronic
1011821823 6:91262064-91262086 ACTCATGGTGGAAGCTGAAGGGG + Intergenic
1012051458 6:94350394-94350416 ACTCCTACTGGAAGAATAACAGG - Intergenic
1012188787 6:96255130-96255152 AATCGTGGCGGAAGATGAAGGGG + Intergenic
1013584965 6:111570306-111570328 ATTCTTACTGGAAGATGAAGAGG - Intronic
1014641082 6:123911341-123911363 ACTCATAGTGGAAGGTGAAAGGG + Intronic
1015520893 6:134130263-134130285 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1015652337 6:135477712-135477734 ATTCGTGGTGGAAGGTGAAGGGG - Intronic
1016027106 6:139298961-139298983 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1017376923 6:153781538-153781560 ACTCATGGTGGAAAATGAAAGGG + Intergenic
1018155513 6:160981868-160981890 AATCATGGTGGAAGATGAAGGGG - Intergenic
1018161233 6:161044788-161044810 ACTCATGGTGGAAGGTGAAGAGG + Intronic
1018267357 6:162039558-162039580 ACTCATGGTGGAAGGTGAAGAGG - Intronic
1018697460 6:166401471-166401493 ATGCGTAGTGGACGCTGAACAGG + Intergenic
1018946482 6:168350026-168350048 AGTCATAGTGGAAGCTGAACAGG + Intergenic
1018994687 6:168701957-168701979 ACTAGTGGTGGAGGAGGAACTGG - Intergenic
1019816355 7:3203995-3204017 AATCACAGTGGAAGGTGAACGGG + Intergenic
1020516581 7:9128597-9128619 ACTCATGGTGGAAGGTGAAATGG - Intergenic
1020989823 7:15182869-15182891 AATCGTGGTGGAAGATGAAGGGG + Intergenic
1021161149 7:17274335-17274357 ACTCATTGTGGAAGGTGAAGGGG - Intergenic
1021519821 7:21527798-21527820 AGTCGTGGTGGAAGGTGAAGGGG - Intergenic
1022416583 7:30183309-30183331 AATCATAGTGGAAGGTGAAGGGG + Intergenic
1022575544 7:31493505-31493527 TCTAGTAGGGGAGGATGAACAGG - Intergenic
1022749194 7:33205425-33205447 ACTGGGAATGGAAGATGACCTGG - Intronic
1024694525 7:51841157-51841179 ACTAGTGGTGGAAGGTGAAGTGG + Intergenic
1026096552 7:67351220-67351242 AATCGTGGTGGAAGATGAAGGGG + Intergenic
1026279998 7:68913813-68913835 ACTCGTGGTGGAAGCTGAAGGGG - Intergenic
1026354328 7:69544283-69544305 AATCATAGTGGAAAATGAAGAGG - Intergenic
1026679210 7:72452529-72452551 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1026702249 7:72656750-72656772 ACTCATGGTGGAAGGTGAAGGGG + Intronic
1026763361 7:73143360-73143382 TATCATAGTGGAAGATGAAGGGG + Intergenic
1027039831 7:74953134-74953156 TATCATAGTGGAAGATGAAGGGG + Intergenic
1027083808 7:75249230-75249252 TATCATAGTGGAAGATGAAGGGG - Intergenic
1031452108 7:121934860-121934882 CCTCGTTGTGGAGGCTGAACAGG + Intronic
1031816775 7:126447825-126447847 AGCCTTAGTGGCAGATGAACTGG - Intronic
1032007374 7:128313851-128313873 AATCATAGTGGAAGGTGAAGTGG - Intronic
1032985553 7:137333211-137333233 ACTCATGGTGGAAGGTGAAAGGG - Intronic
1033594378 7:142845774-142845796 AGTCATGGTGGAAGATGAATAGG - Intergenic
1034108489 7:148513267-148513289 AATCATGGTGGAAGATGAAGAGG + Intergenic
1035639788 8:1176149-1176171 AATTGTGGTGGAAGATGAAGGGG + Intergenic
1036125819 8:6061248-6061270 AATCATGATGGAAGATGAACGGG + Intergenic
1037452523 8:19030586-19030608 AATCGTGGTGGAAGGTGAAGGGG - Intronic
1037573218 8:20176303-20176325 ACTCATGGTGGAAGGTGAAGGGG - Intronic
1038149997 8:24934387-24934409 AATCATGGTGGAAGATGAAGGGG - Intergenic
1038355194 8:26822812-26822834 AATCGTGGTGGAAGGTGAAGGGG + Intronic
1038523529 8:28253855-28253877 ACTCATGGTGGAAGGTGAAACGG + Intergenic
1038684507 8:29704028-29704050 ACTCATTGTGGAAGGTGAAGGGG + Intergenic
1039035166 8:33351569-33351591 ACTCTTGGTGGAAGAGGAAGTGG - Intergenic
1039148816 8:34480210-34480232 AATCATGGTGGAAGGTGAACGGG + Intergenic
1039491350 8:37949911-37949933 ACTCATGGTGGAAGGTGAAGAGG - Intergenic
1040753712 8:50743910-50743932 AGTCATGGTGGAAGATGAAGTGG + Intronic
1041510485 8:58649755-58649777 ACTCATGGTGGAAGGTGAAGTGG - Intronic
1041537435 8:58942915-58942937 ACTGGTGGTGGAAGGTGAAGGGG - Intronic
1041598271 8:59683134-59683156 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1042161994 8:65905726-65905748 AATCATGGTGGAAGATGAAGGGG - Intergenic
1042266228 8:66911358-66911380 AGTCATAGTGGAAGGTGAAGGGG - Intronic
1042490218 8:69389255-69389277 ACTCATTGTGGAAGGTGAAGAGG + Intergenic
1042607226 8:70557655-70557677 ACTCCTGGTGGAAGGTGAAGGGG - Intergenic
1042715667 8:71769857-71769879 TCTGGTACTGGAACATGAACTGG - Intergenic
1043144815 8:76639697-76639719 AATCATAGTGGAAGGTGAAGGGG - Intergenic
1043266659 8:78274597-78274619 AATCATGGTGGAAGATGAATGGG - Intergenic
1043492622 8:80764320-80764342 AGTCATGGTGGAAGATGAAGGGG + Intronic
1043704856 8:83335461-83335483 AATCATAGTGGAAGGTGAAAGGG - Intergenic
1043798835 8:84580414-84580436 ACTCAAAGTGGAAGATAAAGTGG + Intronic
1044068431 8:87725595-87725617 AATCATAGTGGAAGGTGAAGGGG + Intergenic
1044250448 8:89999639-89999661 AATCATGGTGGAAGATGAAGGGG + Intronic
1045594847 8:103641803-103641825 ACTCATGGTGGAAGATGAAGGGG - Intronic
1046462508 8:114559090-114559112 AATCATAGTGGAAGATGAAGGGG - Intergenic
1046839719 8:118842832-118842854 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1046889111 8:119401482-119401504 ACTCATGGTGGAAGGTGAAGAGG - Intergenic
1047555394 8:125923719-125923741 ACTCATAATGGAAGCTGAGCTGG - Intergenic
1048578882 8:135714700-135714722 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1048783922 8:138030506-138030528 AGTCGTGGTGGAAGGTGAAGGGG - Intergenic
1049830454 8:144698265-144698287 ACTTATGGTGGAAGATGAAGGGG - Intergenic
1050842865 9:10174395-10174417 ACTCATGGTGGAAGGTGAAAGGG - Intronic
1051886603 9:21899555-21899577 AGTCATGGTGGAAGGTGAACGGG + Intronic
1051919919 9:22252507-22252529 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1052089574 9:24312038-24312060 AATCGTGGTGGAAGATGAAGGGG + Intergenic
1052193719 9:25686809-25686831 ACTCGTGGTGGAAGGTGTAGGGG - Intergenic
1053301220 9:36951059-36951081 ACTTGTAGAGGAAGTGGAACTGG - Intronic
1053519603 9:38764397-38764419 CATCATGGTGGAAGATGAACAGG - Intergenic
1054765797 9:69041583-69041605 CCTCGCAGGGGAGGATGAACTGG - Intronic
1055228473 9:74030690-74030712 AGTCATAGTGGAAGTTGAAAGGG - Intergenic
1055320693 9:75080861-75080883 AGTCATGGTGGAAGATGAAGGGG - Intronic
1055367628 9:75562274-75562296 ACTCGTGGTGGAAGGTGAAGGGG + Intergenic
1056597956 9:88023146-88023168 ACTCATGGCGGAAGATGAGCAGG - Intergenic
1057381024 9:94567672-94567694 ACTGACAGTGGAAGATGCACAGG - Intronic
1059043948 9:110843908-110843930 AATCATGGTGGAAGATGAAGGGG - Intergenic
1059355763 9:113698216-113698238 AATCGTGGTGGAAGGTGAAGGGG - Intergenic
1060302453 9:122383300-122383322 AGTCAGAGTGGAAGATGAGCGGG + Intronic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1185676422 X:1852922-1852944 AAACGTAGTGGAATCTGAACTGG + Intergenic
1185742577 X:2545689-2545711 ACTCATGGTGGAAGGTGAAGTGG - Intergenic
1185921419 X:4097127-4097149 ACTCATGGTGGAAGGTGAAGGGG - Intergenic
1186000330 X:5002169-5002191 ACTCATGATGGAAGATGAAGGGG - Intergenic
1187686842 X:21824257-21824279 ACTCATGGTGGAAGGTGAAGGGG + Intergenic
1188016585 X:25113465-25113487 AATCATGGTGGAAGGTGAACGGG + Intergenic
1188875686 X:35427360-35427382 AATCATGGTGGAAGATGAAGGGG - Intergenic
1189869552 X:45368046-45368068 AATCATAGTGGAAGGTGAAGGGG - Intergenic
1190517735 X:51242501-51242523 ACTCATGGTGGAAGGTGAAGAGG + Intergenic
1190707697 X:53044379-53044401 AAGCGTGGTGGAAGATGAAGGGG - Intergenic
1192698007 X:73438394-73438416 AAACATAGTGGAAGATGAAGGGG + Intergenic
1193238978 X:79143927-79143949 ACTCCTAAAGGTAGATGAACAGG - Intergenic
1193533815 X:82688270-82688292 ACTCGGGGTGGAAGGTGAAGCGG - Intergenic
1193828776 X:86261612-86261634 ACTGGGAGTGGAAAATGAAGAGG + Intronic
1193858336 X:86634048-86634070 AATCATGGTGGAAGATGAAGGGG + Intronic
1193929969 X:87541578-87541600 AATCATAGTGGAAGGTGAAAGGG - Intronic
1194019593 X:88670326-88670348 ACTCATAGTGGAAGGTAAAGTGG + Intergenic
1194116586 X:89906411-89906433 ACACATAATGGAAAATGAACAGG + Intergenic
1194853077 X:98892619-98892641 ACTCATGGTGGAAGGTGAAGTGG - Intergenic
1196343573 X:114625522-114625544 ACTCATGGTGGAAGGTGAAGGGG - Intronic
1196926307 X:120636697-120636719 AATCATAGTGGAAGGTGAAGGGG + Intergenic
1197865105 X:131009198-131009220 AATCATGGTGGAAGATGAAGGGG - Intergenic
1200469385 Y:3563594-3563616 ACACATAATGGAAAATGAACAGG + Intergenic
1200649815 Y:5828292-5828314 AATCGTGGTGGAAGGTGAAGGGG + Intergenic
1201434645 Y:13943778-13943800 AATCGTGGTGGAAGGTGAAAGGG - Intergenic