ID: 1185205745

View in Genome Browser
Species Human (GRCh38)
Location 22:49537065-49537087
Sequence CCGCATGGAAACCAGCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185205745_1185205750 -3 Left 1185205745 22:49537065-49537087 CCTCAGTGCTGGTTTCCATGCGG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1185205750 22:49537085-49537107 CGGAGGCAGAGGCAGCTCCTTGG 0: 1
1: 0
2: 1
3: 39
4: 457
1185205745_1185205751 4 Left 1185205745 22:49537065-49537087 CCTCAGTGCTGGTTTCCATGCGG 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1185205751 22:49537092-49537114 AGAGGCAGCTCCTTGGTGACAGG 0: 1
1: 0
2: 1
3: 34
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185205745 Original CRISPR CCGCATGGAAACCAGCACTG AGG (reversed) Intronic
900408851 1:2503965-2503987 CAGCCTGGAAACCATCGCTGAGG + Exonic
903316843 1:22514664-22514686 CTGCATGGAAACCAGGGGTGGGG - Intronic
903667501 1:25017002-25017024 ACGGGTGGAACCCAGCACTGGGG + Intergenic
905514171 1:38549668-38549690 TAGCATGGAATCCACCACTGAGG - Intergenic
905957004 1:42005593-42005615 CAGCATGGGAACCAACACTGGGG - Intronic
907511763 1:54966828-54966850 CGGCATGGTGACCAGCCCTGAGG + Intergenic
909952872 1:81739987-81740009 CAGATTGGAAACCACCACTGTGG + Intronic
910524711 1:88164663-88164685 GCGCAAGGAGAACAGCACTGAGG - Intergenic
916804202 1:168242954-168242976 CAGCATGGAAGCCATCACCGTGG + Exonic
918907050 1:190510134-190510156 CAGCAGGGAAATCAGTACTGGGG - Intergenic
920102916 1:203529241-203529263 CAGCAGGGAAACGAGAACTGGGG - Intergenic
921632438 1:217452019-217452041 ACGAATGGAAAAGAGCACTGCGG + Intronic
923737238 1:236622106-236622128 AGGCATGGAAATCAGCACAGAGG - Intergenic
924856541 1:247880058-247880080 CCACATACAAACCAGCATTGGGG - Intergenic
924951670 1:248890185-248890207 ACGCCTGTAACCCAGCACTGTGG - Intergenic
1063434663 10:6020215-6020237 ACAGATGGAAACCAGGACTGGGG - Intronic
1065515016 10:26516291-26516313 CCGCCTGTAATCCAGCACTTTGG + Intronic
1066377582 10:34871624-34871646 CTGCATGGGAACCAGTGCTGGGG + Intergenic
1077129350 11:962470-962492 ACGCCTGTAACCCAGCACTGTGG + Intronic
1077166314 11:1141029-1141051 CCACTTGGACACCAGCCCTGGGG - Intergenic
1077317946 11:1927608-1927630 CCGCTCTGGAACCAGCACTGAGG + Intronic
1080383394 11:31796576-31796598 CAGGATGGAAACCAGCGGTGGGG + Intronic
1090854376 11:130598817-130598839 ACGCATGTAATCCAGCACTTTGG + Intergenic
1091938601 12:4453914-4453936 CTCCATGGAAACCAGAGCTGGGG + Intergenic
1092281575 12:7101692-7101714 CTGCATGGAAACAACCGCTGGGG + Intronic
1092449232 12:8586325-8586347 CCACATGGAAAACAGCAGGGTGG + Intergenic
1093458685 12:19388831-19388853 ACGCCTGTAATCCAGCACTGTGG - Intergenic
1094415828 12:30214001-30214023 GCACAAGGAAGCCAGCACTGTGG + Intergenic
1096007528 12:48184608-48184630 CCCCAAGGAGACCAGCACAGGGG - Exonic
1096106619 12:48999779-48999801 CCCCATGGAAACCAGCAGAGTGG - Intergenic
1096964383 12:55613645-55613667 CCACATGGCAACAATCACTGAGG - Intergenic
1102124828 12:110471347-110471369 CCGCCTGTAATCCAGCACTCTGG - Intronic
1109676323 13:65679124-65679146 CCCCATAGCAACCAGGACTGGGG + Intergenic
1111279243 13:85997660-85997682 CAGCATGGGAACCAACACTGGGG - Intergenic
1113100016 13:106707163-106707185 CCGGCTGGAAACCAGAGCTGAGG + Intergenic
1115028024 14:28765947-28765969 CCGCGGGGAAACCGGGACTGGGG - Intergenic
1117493976 14:56283450-56283472 CAGCATAGAGACCAGCACAGTGG + Intronic
1118841360 14:69515411-69515433 CTCCATGGGAACCAGTACTGGGG - Intronic
1121040321 14:90740997-90741019 CCTCATGGCAACTAGGACTGCGG + Intronic
1121130943 14:91446897-91446919 CCGCCTGTAATCCAGCACTTTGG + Intergenic
1126467764 15:48976226-48976248 CCGCTTAGTATCCAGCACTGAGG - Intergenic
1128382826 15:67125938-67125960 CTGCATGGAAACCCACACTCGGG + Intronic
1131095643 15:89652868-89652890 TCGCAGGGCAACCCGCACTGGGG + Exonic
1131288340 15:91081587-91081609 CCCCATGGGAACCAGTACTCGGG - Intergenic
1132117908 15:99151058-99151080 CCGCATGGAACTGAGCACTTGGG + Intronic
1132628119 16:902013-902035 CAGCCTGGCCACCAGCACTGGGG + Intronic
1133172996 16:3993197-3993219 CCACGTGGAAACCAGCGCTCAGG - Intronic
1134006166 16:10819910-10819932 GCCCATGGAGACCAGCAGTGGGG - Intergenic
1139646437 16:68334565-68334587 CAGCATGTAACCCAGCTCTGGGG - Intronic
1141156561 16:81601300-81601322 CCCCATGGAAACCAGCAGGCAGG + Intronic
1142594846 17:1024523-1024545 CCGCCTGTAATCCAGCACTGTGG + Intronic
1143100626 17:4502869-4502891 CAGGATGGAGACCAGCCCTGTGG - Intronic
1143648403 17:8247568-8247590 ACGCTTGTAATCCAGCACTGTGG - Intronic
1144188493 17:12820647-12820669 CCACATGGATACCTTCACTGAGG + Intronic
1150217977 17:63480812-63480834 GCCCAAGGAAACAAGCACTGTGG + Intergenic
1150912876 17:69407506-69407528 ACGCATGTAATCCAGCACTTTGG + Intergenic
1151889073 17:76941597-76941619 CCGCCTGTAATCCAGCACTTTGG + Intronic
1151989460 17:77564917-77564939 ACGCCTGTAATCCAGCACTGTGG + Intergenic
1156407479 18:36796753-36796775 GTGCATGGAAACCACCACTCTGG + Intronic
1157442795 18:47723236-47723258 CCTCACTGAAACCAGCCCTGGGG - Intergenic
1157865417 18:51179261-51179283 CCGCCTGTAATCCAGCACTTTGG - Intronic
1159138632 18:64366206-64366228 CAGTATGGAAATTAGCACTGTGG + Intergenic
1159637910 18:70827794-70827816 CCTAATGGAAAACAGCACTTCGG - Intergenic
1160021507 18:75185258-75185280 CCCCCTGGAAACCAGCCCTCAGG - Intergenic
1165494691 19:36145463-36145485 CCGCCTGCAATCCAGCACTTTGG - Intronic
1165814517 19:38633435-38633457 CCGCCTGTAATCCAGCACTTTGG + Intronic
1166341130 19:42137880-42137902 CCCCATGGAAACAAACAGTGTGG + Intronic
1167155223 19:47734489-47734511 CCGCCTGTAATCCAGCACTTTGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1168009027 19:53514908-53514930 CCGCCTGTAATCCAGCACTTTGG - Intergenic
1168408491 19:56123258-56123280 CCAGATGGAAGCCAACACTGAGG + Intergenic
925975592 2:9139924-9139946 CTGCTTGGCCACCAGCACTGAGG + Intergenic
929371675 2:41232354-41232376 CCATATGGAAATCAGCACAGAGG + Intergenic
930712204 2:54559602-54559624 CCGCAGGGAAAACAGCACACTGG - Intronic
932460142 2:71876566-71876588 CCGCATGGACACCTCCAATGTGG - Intergenic
933558847 2:83866469-83866491 CCACATGGAAAGCAGTAGTGAGG + Intergenic
934662247 2:96149151-96149173 CTGCATCCAGACCAGCACTGAGG + Intergenic
937590040 2:123601963-123601985 CTGCATGGAGAGCAGCCCTGAGG - Intergenic
937820635 2:126306699-126306721 CGTCATGGAAAACAGTACTGAGG - Intergenic
940083542 2:149832221-149832243 CTCCATGGGAACCAGTACTGGGG - Intergenic
944540117 2:200746499-200746521 CCTCCTGGAATCCAGCCCTGAGG + Intergenic
945683162 2:212937622-212937644 ACGCCTGGAATCCAGCACTCTGG + Intergenic
1172548430 20:35780172-35780194 CAGCCTGGAAACCAGCACTGAGG + Intronic
1173984704 20:47252031-47252053 ACGCCTGTAATCCAGCACTGTGG + Intronic
1174175997 20:48645296-48645318 CTGCAGATAAACCAGCACTGTGG - Intronic
1174796384 20:53526031-53526053 ACGCCTGTAAACCAGCACTTTGG - Intergenic
1176180316 20:63746774-63746796 CCCCACGGAAACCAGCCCTGCGG - Exonic
1178833077 21:36072522-36072544 CCGCAGTGAGACCATCACTGAGG + Exonic
1179357719 21:40676853-40676875 TCGCTTGGAAATCAGAACTGTGG + Intronic
1182719103 22:32383494-32383516 CCGCAAGGATCACAGCACTGAGG - Intergenic
1183588740 22:38767956-38767978 CAGCATGGACAGCAGCACTGGGG + Intronic
1184321913 22:43748369-43748391 CCGCAAGGAGACAAGCCCTGCGG - Intronic
1184802625 22:46770829-46770851 CTGCATGGAAAACAGGACTGAGG - Intronic
1185197420 22:49481059-49481081 ACGCCTGGAATCCAGCACTGTGG + Intronic
1185205745 22:49537065-49537087 CCGCATGGAAACCAGCACTGAGG - Intronic
952218133 3:31297760-31297782 TAGCTTGGAAACCACCACTGAGG + Intergenic
953355474 3:42252817-42252839 ACGCCTGTAATCCAGCACTGTGG - Intergenic
955774610 3:62420145-62420167 CTGCTTGGAAACCAGCTGTGTGG - Intronic
956399268 3:68859693-68859715 ACGCAGGGAAAGCAGCACTAAGG + Intronic
961492622 3:127265837-127265859 CCGCACTGAAGCCAGCACTCGGG - Intergenic
961655268 3:128438383-128438405 TTGCATGGAAGTCAGCACTGGGG - Intergenic
961680023 3:128593656-128593678 CAGCATGGAGCCCAGCGCTGAGG + Intergenic
962811633 3:138963355-138963377 GCGCATGGGAAGCGGCACTGTGG - Intergenic
963123427 3:141794796-141794818 CCGTATCCAAACCATCACTGAGG - Intronic
966595752 3:181723556-181723578 CCGCATGGACACCAGGAATGCGG + Intergenic
966656321 3:182362437-182362459 CCTCATTGAAACCAGCCCTGTGG + Intergenic
980914016 4:139017567-139017589 ACGCCTGTAATCCAGCACTGTGG + Intronic
981432697 4:144679637-144679659 CCGGATGAAAACAAGCAATGGGG - Intronic
981776035 4:148368700-148368722 TGGTATGGAAACCAGCAATGGGG + Intronic
982472636 4:155811862-155811884 ACGCCTGTAAACCAGCACTTTGG + Intergenic
983428342 4:167616061-167616083 ACGCCTGTAATCCAGCACTGTGG - Intergenic
986128689 5:4907470-4907492 CCCCAGGGAAAAAAGCACTGAGG + Intergenic
987216099 5:15738942-15738964 CCACATTGTCACCAGCACTGAGG + Intronic
990602239 5:57370816-57370838 CTGCTTGGAATCCTGCACTGTGG - Intergenic
996560568 5:124824081-124824103 TAGCATGGAAATCAGCACTTCGG - Intergenic
997877912 5:137565673-137565695 CTGCTGGGAAACTAGCACTGGGG - Intronic
998141262 5:139700890-139700912 CCGCATGGAAGCCAGCGCCCTGG - Intergenic
998700911 5:144698680-144698702 CTGCAGGGAAAGCAGCAATGAGG - Intergenic
1000303250 5:159973657-159973679 CTGCCTGGAAAAAAGCACTGAGG + Intergenic
1000995612 5:167955732-167955754 CCCGATGGAAACAAGCAATGGGG - Intronic
1006163141 6:32049549-32049571 CCCCACAGAACCCAGCACTGAGG - Intronic
1006164395 6:32056130-32056152 CCCCACGGAACTCAGCACTGAGG - Intronic
1007284138 6:40735695-40735717 CCCCAGGGCAACCAGCTCTGAGG - Intergenic
1008146365 6:47896426-47896448 CTTCATGGAAAACAGCAATGTGG - Intronic
1008182944 6:48355842-48355864 CCACAGGGAGGCCAGCACTGTGG + Intergenic
1010888440 6:81272905-81272927 CCACATGGAAAACAGTATTGAGG + Intergenic
1013262807 6:108463026-108463048 ACGCCTGTAATCCAGCACTGTGG + Intronic
1013839412 6:114372468-114372490 CAGCCTGGAGACCATCACTGTGG - Intergenic
1017089024 6:150742304-150742326 ACGCCTGGAATCCAGCACTCGGG + Intronic
1017201061 6:151755521-151755543 GAGCAGGGAAACCAGCTCTGCGG - Intronic
1019335289 7:479913-479935 CTGCCTGGAAACCATGACTGGGG - Intergenic
1020195117 7:6031846-6031868 CCACATGGAGATCATCACTGTGG - Intronic
1023775043 7:43597643-43597665 ACGCCTGTAAACCAGCACTTTGG - Intronic
1027967316 7:85028654-85028676 CAGCACTGAAACCAGTACTGAGG + Intronic
1031726152 7:125242042-125242064 CCTTATGAAAACCATCACTGTGG + Intergenic
1033543571 7:142379758-142379780 CTGAAAGGAAACCAGCACAGGGG + Intergenic
1034491511 7:151395579-151395601 CCTCACGGAAACCAGTACTGCGG + Intronic
1034530036 7:151689843-151689865 CACCATGGAAACGAGCTCTGGGG - Intronic
1035033915 7:155882959-155882981 CCACATGGAAGTCAGCAATGGGG - Intergenic
1035036638 7:155899789-155899811 CCTCAGGGACCCCAGCACTGGGG + Intergenic
1036578527 8:10051712-10051734 CCTCCTGGAAAACAGAACTGGGG + Intergenic
1036679528 8:10860959-10860981 CCAGGTGGAAACCAGGACTGTGG - Intergenic
1037481601 8:19311358-19311380 ACGCATGTAACCCAGCACTTTGG + Intergenic
1040993794 8:53380232-53380254 CCGCATGGAAAATAGCACAGTGG - Intergenic
1042518611 8:69685765-69685787 CCTCAAGAAAACCAGCCCTGGGG + Intronic
1045785178 8:105912660-105912682 CTTCATGGAAACCAGGAGTGAGG - Intergenic
1047201881 8:122774052-122774074 CCTCCTGGAAACCAGGAGTGGGG + Intergenic
1047418660 8:124687226-124687248 CTGCATGGAAACCAGGGCTTGGG + Intronic
1047717956 8:127613157-127613179 CCCCATGGAAATAAGCACTCAGG + Intergenic
1049339702 8:142105549-142105571 CCGCATGAACACCAGGCCTGCGG + Intergenic
1050402838 9:5274552-5274574 CTCTATGGGAACCAGCACTGGGG + Intergenic
1050446904 9:5733522-5733544 ACGCCTGTAATCCAGCACTGTGG - Intronic
1053203920 9:36170840-36170862 CTGCTTTGACACCAGCACTGGGG + Exonic
1055979481 9:81988093-81988115 CCCCATGAAAGCCAGCACAGGGG + Intergenic
1059739929 9:117140205-117140227 TGGCATGGGAAACAGCACTGAGG + Intronic
1060105064 9:120868613-120868635 CCGCGTGGCATCTAGCACTGTGG - Intronic
1060987410 9:127827753-127827775 ACGCCTGTAAACCAGCACTTTGG + Intronic
1062579783 9:137224174-137224196 ACGCCTGGAATCCAGCACTTTGG + Intergenic
1187644163 X:21328535-21328557 CTGCAGGCAAAACAGCACTGGGG - Intergenic
1190042774 X:47084692-47084714 CCGCCTGTAATCCAGCACTTTGG + Intronic
1192734812 X:73840321-73840343 AGGCATGGAAACAAGCCCTGAGG + Intergenic