ID: 1185206287

View in Genome Browser
Species Human (GRCh38)
Location 22:49541091-49541113
Sequence GAGGAGCGAGGCCGGGTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185206287_1185206298 14 Left 1185206287 22:49541091-49541113 CCCCGAACCCGGCCTCGCTCCTC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1185206298 22:49541128-49541150 GGAGCGAATGCGCAGTCCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1185206287_1185206293 -9 Left 1185206287 22:49541091-49541113 CCCCGAACCCGGCCTCGCTCCTC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1185206293 22:49541105-49541127 TCGCTCCTCAGCTGCGCACTTGG 0: 1
1: 0
2: 0
3: 13
4: 69
1185206287_1185206294 -8 Left 1185206287 22:49541091-49541113 CCCCGAACCCGGCCTCGCTCCTC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1185206294 22:49541106-49541128 CGCTCCTCAGCTGCGCACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1185206287_1185206295 -7 Left 1185206287 22:49541091-49541113 CCCCGAACCCGGCCTCGCTCCTC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1185206295 22:49541107-49541129 GCTCCTCAGCTGCGCACTTGGGG 0: 1
1: 0
2: 0
3: 15
4: 111
1185206287_1185206299 17 Left 1185206287 22:49541091-49541113 CCCCGAACCCGGCCTCGCTCCTC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1185206299 22:49541131-49541153 GCGAATGCGCAGTCCCTGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 64
1185206287_1185206297 13 Left 1185206287 22:49541091-49541113 CCCCGAACCCGGCCTCGCTCCTC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 1185206297 22:49541127-49541149 GGGAGCGAATGCGCAGTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185206287 Original CRISPR GAGGAGCGAGGCCGGGTTCG GGG (reversed) Intronic
900151999 1:1182820-1182842 GAGGGGCGTGGCTGGGTTGGGGG + Intronic
904483251 1:30807243-30807265 TAGGAGTGAGGTCGGGTTGGGGG + Intergenic
910449080 1:87328810-87328832 GAGGAGCGCGGGCGGGGGCGGGG + Exonic
915557039 1:156666580-156666602 GAAGAGAGAGCCAGGGTTCGGGG - Intergenic
915908924 1:159900211-159900233 GAGGGGCGGGGCCGGGGGCGGGG - Intergenic
915937826 1:160099088-160099110 GCGGGGCGAGGCCGGGGTCCAGG - Intergenic
918040041 1:180908387-180908409 GAGGAGCGAGGGCGCGTGCAGGG - Intergenic
918048340 1:180954366-180954388 GTGGAGGGAGGGCGGGCTCGCGG + Intergenic
920331515 1:205211574-205211596 GAGGAGGGAGGCCGGGCCTGCGG - Intergenic
922472181 1:225883165-225883187 GGGAAGCGAGGCTGGGTTCGGGG + Intergenic
923631368 1:235650649-235650671 GGGGAGCGAGGCCGGGAGGGCGG + Intronic
1063929773 10:11017789-11017811 GCGGGGCGGAGCCGGGTTCGGGG + Intronic
1065214690 10:23438858-23438880 GCGGGGCGAGGCCGGGGGCGCGG - Intergenic
1065483928 10:26218172-26218194 GAGCTCCGAGGCCAGGTTCGGGG - Intronic
1067013894 10:42741005-42741027 GAAGAGCAAGGCCGGGTACCTGG + Intergenic
1067443629 10:46327148-46327170 GAGGAGCGAGGGAGGGTGCCAGG + Intronic
1072542239 10:96406930-96406952 GAGGAGCGAGATGGGGTTAGAGG - Intronic
1073431838 10:103492245-103492267 GAGGCTGGAGGCCGGGTTCGGGG + Intergenic
1074564397 10:114564170-114564192 GAGCAACGAGGCCGGGTCCAGGG - Intronic
1075015970 10:118910286-118910308 GAGGAGAGGGGCTGGGGTCGAGG - Intergenic
1076916407 10:133424776-133424798 GTGGAGCGGGGCCGGGTGCGGGG - Intergenic
1076936514 10:133569571-133569593 GTGGAGCGGAGCCGGGTGCGGGG - Intronic
1077332889 11:1991052-1991074 CAGGCGGGAGGCCGGGTCCGCGG - Intergenic
1077437936 11:2552683-2552705 GGGGAGAGAGACCGTGTTCGTGG - Intronic
1077437944 11:2552746-2552768 GGGGAGCGAGACCGTGTTCGTGG - Intronic
1077437951 11:2552809-2552831 GGGGAGCGAGACAGTGTTCGTGG - Intronic
1077437958 11:2552872-2552894 GGGGAGCAAGACCGTGTTCGTGG - Intronic
1081576099 11:44319349-44319371 GAGGAGCGAGGCGGACATCGGGG + Intergenic
1083246050 11:61429423-61429445 GCGGCGCGAGGCCGGGGGCGGGG - Intronic
1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG + Exonic
1084621074 11:70270701-70270723 GAGGAGCGGGCCCGGCTGCGCGG - Exonic
1084810254 11:71607611-71607633 GAGGAGGGAGGCTGAGTCCGTGG - Intergenic
1085303402 11:75471776-75471798 GAGGAGCTAGGCAGGGTGTGGGG + Intronic
1085640571 11:78190046-78190068 AAGGAGGGAGGCTGGCTTCGAGG + Intronic
1087613933 11:100467090-100467112 TAGGAGTGAGGCCGGGTTGGGGG - Intergenic
1089209730 11:116791881-116791903 GTGGAGGGAGGCCTGGTTAGGGG + Exonic
1090902788 11:131047258-131047280 AAGGAGTGAGGCTGGGGTCGGGG + Intergenic
1090946418 11:131433413-131433435 TAGGAGAGAGGCCTGGTTAGTGG - Intronic
1202815872 11_KI270721v1_random:46228-46250 CAGGCGGGAGGCCGGGTCCGCGG - Intergenic
1092169509 12:6364215-6364237 GAGGAGGGAGGCGGGGTGGGTGG - Intronic
1095812296 12:46383640-46383662 GAGGAGGGGGGAAGGGTTCGGGG + Intergenic
1096599222 12:52717684-52717706 GAGGAGCTAGGCCGAGGCCGAGG - Intergenic
1101782074 12:107845577-107845599 GAGGAGCGAGGCTGGGGACAGGG + Intergenic
1103308785 12:119988830-119988852 TGAGAGCGAGGCCGGGTGCGAGG + Intergenic
1103894201 12:124262315-124262337 GAGGGGCCAGGCCTGGTTCGCGG - Intronic
1105011762 12:132761393-132761415 GAGGGGCCACGCCGGGTTCGGGG - Intronic
1112500820 13:99941756-99941778 GTGCAGCGAGGCCAGGTGCGTGG - Intergenic
1113469522 13:110534487-110534509 GAGGGGCAAGGCAGGGGTCGGGG - Intronic
1114270945 14:21099574-21099596 GAGGAGGGAGGCAGGGTCCTGGG - Intronic
1119480878 14:74956847-74956869 GAGGAGCGAGGCCTGGGAAGTGG + Intergenic
1122116705 14:99531197-99531219 GGGGAGCGAGGCTGGGGTCTGGG - Intronic
1122183300 14:99971334-99971356 GAGGGGCGTGGCCGGGGTGGGGG - Intergenic
1122828553 14:104384026-104384048 GAGGAGTGAGGCTGGGCTGGGGG + Intergenic
1125551629 15:40549461-40549483 TAGGAGAGAGGCCGTGTTAGGGG - Intronic
1126036150 15:44547733-44547755 AAGGAGTCAGGCCGGGTGCGTGG - Intronic
1126351825 15:47751942-47751964 GAGGAGCGAGGCTTGGTAGGTGG + Intronic
1127763439 15:62163942-62163964 GAGGGTCGCGGCCGGGATCGGGG - Exonic
1128944017 15:71809539-71809561 GAGCTGTGAGGCCGAGTTCGGGG + Intronic
1130932250 15:88437880-88437902 GAGGAGCTAGGCTGGCTCCGGGG + Intergenic
1132830634 16:1926431-1926453 GAGGGGCGAGGCAGGGGTGGGGG - Intergenic
1133573536 16:7065400-7065422 GAGGAACGAGGCAGGGTGCTTGG - Intronic
1136146898 16:28321289-28321311 GAGCAACGAGTCCGGGTTCCAGG - Exonic
1136568785 16:31084800-31084822 GGGGAGCGTGGCTGGGTTCTGGG - Exonic
1136724812 16:32349007-32349029 GAGGGGCGAGGCGGGGCGCGCGG - Intergenic
1136923376 16:34350251-34350273 GGGGAGCGCGGCCTGGTGCGGGG - Intergenic
1136981197 16:35061555-35061577 GGGGAGCGCGGCCTGGTGCGGGG + Intergenic
1140927862 16:79600261-79600283 GAGGAGCCCGGCCCGGTGCGCGG + Exonic
1142179818 16:88662953-88662975 CGGGAGCGAGGCCGGGTACGCGG - Intronic
1142315763 16:89344033-89344055 GAGGGGCGGGGCCGGGCTTGAGG - Intronic
1142441920 16:90103959-90103981 GAGGAGCAAGGCCTGGGTCGGGG - Intergenic
1203001618 16_KI270728v1_random:168748-168770 GAGGGGCGAGGCGGGGCGCGCGG + Intergenic
1203133221 16_KI270728v1_random:1705154-1705176 GAGGGGCGAGGCGGGGCGCGCGG + Intergenic
1142625119 17:1186984-1187006 GAGGAGCACGGCCAGCTTCGGGG - Intronic
1142676509 17:1516743-1516765 GCTGAGCGAAGACGGGTTCGCGG + Exonic
1142810245 17:2392789-2392811 GAGGGGCGGGGCCGGGCTCGCGG - Intronic
1143166815 17:4900944-4900966 CGGGAGCGAGCCCGGGTTTGGGG + Exonic
1144408087 17:14972239-14972261 GAAGAGGGAGACTGGGTTCGAGG - Intergenic
1144624264 17:16836788-16836810 GAGGAAGGAGGCAGGGTGCGGGG - Intergenic
1144771454 17:17761866-17761888 GAGGAGCGAGGGCAGGTGGGGGG + Intronic
1144882165 17:18435931-18435953 GAGGAAGGAGGCAGGGTGCGGGG + Intergenic
1145150068 17:20508455-20508477 GAGGAAGGAGGCAGGGTGCGGGG - Intergenic
1146787408 17:35731911-35731933 GTGGAGCGGGGCCGGGTCAGGGG + Intronic
1147134731 17:38428404-38428426 GAGGGGCGGGGCCGGGGGCGGGG - Exonic
1150137652 17:62704330-62704352 GGGGGGCGAGGCCGGGGTCGGGG + Intronic
1152254018 17:79227031-79227053 GGGGAGCAAGGCGGGGTTGGAGG - Intronic
1152791586 17:82283115-82283137 GAGGAGTGAGGCCTGGTGCCCGG + Intergenic
1154161024 18:11981191-11981213 GAGGGGCGGGGCCAGGTACGGGG + Intronic
1160499209 18:79394181-79394203 GAGGACCGCGGCTGGGGTCGAGG + Intergenic
1160910492 19:1471685-1471707 GAGGAACGAAGCAGGGTTTGAGG + Exonic
1161007122 19:1942243-1942265 GAGGAGCCAGGCGGGGATCGGGG - Intronic
1161267842 19:3373201-3373223 GAGGAGAGAGGCAGGGAGCGAGG - Intronic
1161289032 19:3483080-3483102 GAGGAGGGTGGCCGGGGCCGGGG - Intergenic
1161569880 19:5024594-5024616 GAGGAGCCAGGCCTGGCCCGTGG + Intronic
1161975406 19:7605651-7605673 GAGGAGCCAGGCCTGGTGGGAGG - Intronic
1163118757 19:15203179-15203201 GAGGAGAGATGCTGGGTTTGAGG + Intergenic
1166803742 19:45472981-45473003 GAGGAGGGAGGGCGAGTTCAGGG - Exonic
1167507487 19:49878468-49878490 AAGGAGGGAGGCGGGGTTAGAGG - Intronic
1168407719 19:56119698-56119720 GAGGGGCCAGGCCGGGTGCCCGG + Intronic
925942922 2:8837395-8837417 CGGGGGCGAGGCCGGGCTCGGGG - Intronic
927520562 2:23695794-23695816 GAGAGGCGCGGCCGGGTTCGGGG - Exonic
927905000 2:26849267-26849289 GAGGAGGGAGGACGGGAGCGAGG + Intronic
928371211 2:30741542-30741564 GAGGAACGATGCCAGGTTGGTGG + Intronic
934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG + Exonic
937094498 2:119226566-119226588 GAGGAGAGGGGCAGGGATCGGGG + Intronic
938291014 2:130150566-130150588 GAGGAGGGAGGCCAGGCTGGAGG - Intergenic
938465530 2:131522390-131522412 GAGGAGGGAGGCCAGGCTGGAGG + Intergenic
940504479 2:154535416-154535438 GTGGAGCGTGTCCGGGTTCTTGG - Intergenic
941384994 2:164841554-164841576 GAGGAGCGGGGCCGGGCGCACGG + Intronic
943652042 2:190467631-190467653 AAGGAGCGAGGCCAGGTCAGTGG + Intronic
946386804 2:219388365-219388387 GAGGAGCGGGGCGGGGTGGGCGG - Intronic
947373162 2:229468814-229468836 GAGGAGTGAGGGAGGGTTCTGGG + Intronic
948814719 2:240504010-240504032 GAGGATGGAGGCCGCGATCGAGG - Intronic
1168891202 20:1296300-1296322 GAGGAGAGAGGGCGGGTTGGGGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173228422 20:41175550-41175572 GAGGACAGAGGCCGGGGTCCAGG + Exonic
1174202938 20:48819893-48819915 GAGGAGCGAGGCCGGGGTCAGGG - Intronic
1174631785 20:51964628-51964650 GAGGAGAGAGGCTGGGTAAGAGG + Intergenic
1175237567 20:57525192-57525214 GCGGAGCCAGGCAGGGTTGGGGG + Intronic
1176162195 20:63653547-63653569 GAGGAGGGAGGGAGGGTTGGGGG + Intergenic
1176286690 21:5022455-5022477 GAGGAGCCAGGCCGGGGGCGGGG + Intergenic
1178517958 21:33264659-33264681 GTGGATCTAGGCCGGGTTGGGGG + Intronic
1179870491 21:44241020-44241042 GAGGAGCCAGGCCGGGGGCGGGG - Intergenic
1180951329 22:19721971-19721993 GAGGGGCGAGGTCTGGCTCGCGG - Intronic
1181038354 22:20180434-20180456 CAGCAGCCAGGCCGGGCTCGGGG - Intergenic
1181269795 22:21652400-21652422 GAGGGGCGCGGCCGGGATCCCGG + Intronic
1182255364 22:29033786-29033808 GAGGAGGGAGCCCAGGTTTGGGG + Intronic
1184098509 22:42329476-42329498 GAGGAGAGAAGCGGGGCTCGAGG + Intronic
1184146522 22:42614670-42614692 GAGGAGCGCGGCTGTGGTCGGGG + Intronic
1184439201 22:44498247-44498269 CAGGGGCGGGGCCGGGGTCGCGG + Exonic
1184859795 22:47166823-47166845 GAGGAGAGAGGCCGGGGTACAGG + Intronic
1185206287 22:49541091-49541113 GAGGAGCGAGGCCGGGTTCGGGG - Intronic
950446308 3:13040840-13040862 GAGGAGCAGGGCTGGGTGCGGGG - Intronic
950464964 3:13148282-13148304 GAGGAGGGAGGCCTGGTACGGGG + Intergenic
950795354 3:15505992-15506014 GAGGAGGGAGGCTGGGTTCCTGG + Intronic
957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
958719112 3:97822598-97822620 GCGGAGCCAGGCGGGGATCGGGG - Intronic
961213358 3:125142045-125142067 GGCGCGCGAGGCCGGGTGCGAGG - Intronic
966883356 3:184361862-184361884 GAGGGGCCGGCCCGGGTTCGCGG + Intronic
968081021 3:195847186-195847208 GAGGAGCGAGGCCCAGGGCGGGG - Intergenic
968353369 3:198080876-198080898 GAGGAGCGGGGCGGGGGTCACGG - Intergenic
968362187 3:198154926-198154948 GAGGAGAAAGGCCTGGGTCGGGG - Intergenic
968455990 4:700024-700046 GAGGGGCGAGGCTGGGTGGGGGG + Intergenic
968456882 4:704765-704787 GAGGACCGAGGGCGCGTGCGGGG - Intergenic
969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
969714057 4:8860064-8860086 CAGGGGCGAAGCCGAGTTCGTGG + Intronic
969732206 4:8963995-8964017 GAGGAGGGAGGCTGAGTCCGGGG - Intergenic
971030606 4:22633753-22633775 GAAGAGTGAGGCTGGGTTAGGGG - Intergenic
971294540 4:25377087-25377109 GAGGAGCGAGGGGCGGATCGAGG - Intergenic
973110328 4:46390136-46390158 GAGGAGTCAGGCCGGGTAGGAGG + Intronic
983859826 4:172691657-172691679 GGGGAGTGAGGCAGGGTTCTTGG - Intronic
990545359 5:56816058-56816080 GAGCAGCACGGCCGGGGTCGCGG + Intronic
992502253 5:77354731-77354753 GAGGAGCAAGGCTGAGTTGGTGG - Intronic
1001928788 5:175658282-175658304 GAGGCTCGAACCCGGGTTCGGGG - Intronic
1002635947 5:180608892-180608914 GAGGAGGGAGGCTGGGGTCTGGG - Intronic
1006136974 6:31901490-31901512 GAGGAGGGAGGCGTGGTTCTCGG + Intronic
1009975750 6:70668442-70668464 TAGGAGCGAGGCTGGGAGCGCGG + Intronic
1013624210 6:111920713-111920735 GAGGAGCGGGCCTGGATTCGGGG + Intergenic
1019253493 7:33781-33803 GAGGAGCAAGGCCTGGGTCGGGG + Intergenic
1019383528 7:740635-740657 GAGGCGCGTGGCCGGGGTCCTGG - Intronic
1020080258 7:5282888-5282910 GAGGGGCGGGGCCGGGCGCGGGG + Intronic
1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG + Intergenic
1022428037 7:30285841-30285863 GAGGACCGAGCGCGGGTGCGCGG - Intronic
1023945041 7:44796612-44796634 GAGGCGCGAGACCGGGTTGCGGG + Intergenic
1024164824 7:46720445-46720467 GAGGAGCGAGCCCTGGGTGGAGG + Intronic
1024213727 7:47228806-47228828 GTGGAGGGAGGCGGGGTTGGAGG - Intergenic
1024213736 7:47228828-47228850 GAGGAGGGAGGCGGGTTTGGAGG - Intergenic
1030358571 7:108570106-108570128 GAGGGACGAGGCCGGGGTCGTGG + Intronic
1031586218 7:123534707-123534729 GAGGAGCGCGGCAGGGTAGGGGG + Intronic
1037305343 8:17497680-17497702 AAGGAGCGAAGGCGGCTTCGGGG - Intronic
1039862806 8:41473558-41473580 GAGGAGCAAGGGCGGGGTGGAGG + Intergenic
1040914969 8:52559391-52559413 GAGGAGTGTGGCTGGGTTTGGGG + Intronic
1041739733 8:61145525-61145547 GAGGAGCCAGGCCAGGTCCTTGG + Intronic
1049555080 8:143277634-143277656 GAGGAGCCAGGCTGGGGTCCGGG - Intergenic
1049645342 8:143733533-143733555 GTGGAGCGCGGCCGCGTGCGCGG - Intronic
1049716368 8:144094996-144095018 GCGGGGCGGGGCCGGGCTCGGGG - Intergenic
1053163604 9:35829595-35829617 GAGGGCCGAGGCCGGGATGGGGG - Exonic
1053302095 9:36959560-36959582 GAGGAGAGAGGCAGGGTGAGAGG + Intronic
1057192419 9:93095418-93095440 GGGGCGCGAGGCCGGGAGCGGGG + Intergenic
1057801302 9:98192769-98192791 CAGGAGCGCGGTCGGGGTCGTGG - Intergenic
1059208301 9:112486917-112486939 GAGGAGCGGGGCGGGGGGCGGGG - Intronic
1059702031 9:116784639-116784661 GAGGAGAGAGGCTGTGTTGGGGG + Intronic
1061617313 9:131788694-131788716 GAGGAGTGAGGCCAGGGTTGGGG + Intergenic
1061765426 9:132878448-132878470 GAAAAGCGAGGCCGGGGTTGGGG - Exonic
1062629943 9:137459048-137459070 GAGGAGCGAGGCCATGTCCTCGG - Exonic
1062680217 9:137775155-137775177 GAGGAGCGGGGCCTTGTTGGAGG - Exonic
1062746877 9:138218588-138218610 GAGGAGCAAGGCCTGGGTCGGGG - Intergenic
1187507284 X:19887784-19887806 GAGGGGCGGGGCCGGGGCCGGGG + Intergenic
1189325494 X:40108732-40108754 GAGGAGCCCGGCCGGATCCGAGG - Intronic
1198750521 X:139932848-139932870 GAGGGGCGGGGCGGGGTGCGAGG + Intronic
1199649601 X:149939214-149939236 GTGGGGCGGGGCGGGGTTCGGGG + Intergenic