ID: 1185208364

View in Genome Browser
Species Human (GRCh38)
Location 22:49553093-49553115
Sequence GTACCTCAGACGAGGCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185208364_1185208368 23 Left 1185208364 22:49553093-49553115 CCTGGGAGCCTCGTCTGAGGTAC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1185208368 22:49553139-49553161 ATTTTTCAAAATCCAGCAGGAGG 0: 1
1: 0
2: 0
3: 33
4: 336
1185208364_1185208369 24 Left 1185208364 22:49553093-49553115 CCTGGGAGCCTCGTCTGAGGTAC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1185208369 22:49553140-49553162 TTTTTCAAAATCCAGCAGGAGGG 0: 1
1: 0
2: 4
3: 52
4: 649
1185208364_1185208367 20 Left 1185208364 22:49553093-49553115 CCTGGGAGCCTCGTCTGAGGTAC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1185208367 22:49553136-49553158 TGCATTTTTCAAAATCCAGCAGG 0: 1
1: 0
2: 1
3: 32
4: 290
1185208364_1185208370 29 Left 1185208364 22:49553093-49553115 CCTGGGAGCCTCGTCTGAGGTAC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1185208370 22:49553145-49553167 CAAAATCCAGCAGGAGGGAACGG 0: 1
1: 0
2: 3
3: 40
4: 886

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185208364 Original CRISPR GTACCTCAGACGAGGCTCCC AGG (reversed) Intronic
900101035 1:962199-962221 GAGCCACAGACGAGGCTCCTGGG - Intronic
900337176 1:2169986-2170008 GTGCCTCAGACCAGTCCCCCAGG + Intronic
900420141 1:2552735-2552757 GGACCTCAGAAGAGGCTCTGGGG - Intergenic
900424290 1:2568923-2568945 GGACCTCAGAAGAGGCTCTGGGG + Intergenic
900535105 1:3173126-3173148 GAATCACAGCCGAGGCTCCCTGG - Intronic
903065442 1:20696877-20696899 GTAGCTCTGGGGAGGCTCCCGGG - Intronic
913569952 1:120110153-120110175 GAACCTCGGAGGAGGCGCCCAGG + Intergenic
914290760 1:146271118-146271140 GAACCTCGGAGGAGGCGCCCAGG + Intergenic
914551804 1:148721901-148721923 GAACCTCGGAGGAGGCGCCCAGG + Intergenic
920418133 1:205812503-205812525 GAACCTGAGAGGGGGCTCCCAGG + Intronic
1063104684 10:2982767-2982789 GTGCCTCAGACCAGCCTCCAGGG - Intergenic
1064266290 10:13828051-13828073 GTGCCTCAGACGAGGCCTGCTGG - Intronic
1067055243 10:43046159-43046181 GTCCCTCTGACGAGGCACCCAGG + Intergenic
1074699676 10:116082250-116082272 GTAAGTCAGATGAAGCTCCCAGG + Intronic
1077546195 11:3171069-3171091 CTCACTCAGACGATGCTCCCTGG + Intergenic
1078670227 11:13357856-13357878 ATTCCTCAGAGGAGGCTCCTGGG + Intronic
1080617487 11:33957331-33957353 GTACCTCAGACCATCTTCCCAGG - Intergenic
1083853030 11:65378887-65378909 GGGCCTCAGGTGAGGCTCCCAGG + Intronic
1085347608 11:75778347-75778369 GTAGCGCAGAGGAGGCTCCAAGG - Intronic
1090120698 11:124023783-124023805 TTACCTGAGACCAGGCTCCAGGG + Exonic
1098658876 12:73068245-73068267 CTACCTGAGACAAAGCTCCCAGG - Intergenic
1101957543 12:109224234-109224256 GTGCCTCAGACTTGGCTCTCAGG - Intronic
1107726175 13:43301825-43301847 ATTCCTCAGACAAGGCTGCCTGG + Intronic
1112369379 13:98781800-98781822 GTACCTCAGAGCGGGCCCCCAGG + Intergenic
1119685232 14:76625909-76625931 GTAGCACAGAAGAGGCTCCAAGG - Intergenic
1125716460 15:41822479-41822501 CTACCTGAGAGGAGGGTCCCAGG + Intronic
1128977130 15:72162193-72162215 GAACCTCAGGCCAGGCTGCCTGG - Intronic
1132357269 15:101181073-101181095 GTGCCTCAGAAGACGCTCCCAGG + Intronic
1132837120 16:1959736-1959758 GTACCTCTCACGAGGGTCACGGG - Exonic
1133153404 16:3854100-3854122 GTTCCTCAGAGGAACCTCCCAGG - Intronic
1136622640 16:31440203-31440225 GTAGTTCAGAGGAAGCTCCCTGG - Intronic
1143284847 17:5781316-5781338 GACCCTCAGAGGAGGATCCCAGG - Intronic
1152229107 17:79105863-79105885 GTGGCTCAGCCCAGGCTCCCAGG - Intronic
1157796316 18:50578848-50578870 GTGACTCAGAGGAGGCTTCCAGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1161407602 19:4099197-4099219 GTACCGCTGACGGGGCGCCCGGG + Exonic
1161572200 19:5036663-5036685 GTGCCTCACACGGGGCTCCTGGG - Intronic
1161577278 19:5061258-5061280 TTCCCTGAGCCGAGGCTCCCAGG + Intronic
1162944243 19:14032462-14032484 GTAACTCGGAGGGGGCTCCCAGG - Exonic
1163676745 19:18659214-18659236 GGATCTCAGACAAGGCTCTCAGG + Intronic
1164804104 19:31102884-31102906 GGAAATCAGAGGAGGCTCCCTGG - Intergenic
1166588206 19:43969761-43969783 CTACCTCAGATGGAGCTCCCAGG + Intronic
1168270526 19:55247371-55247393 GGACCTCAGGCGAGGCGGCCGGG - Intronic
927718648 2:25368865-25368887 GGACCTCAGAGGAGGCGCGCTGG + Intergenic
928236335 2:29544741-29544763 GTAACTCAGAGGAGGTTTCCAGG - Intronic
930348995 2:50225172-50225194 GTACCTCATACTATGCTCCAAGG + Intronic
932570194 2:72934439-72934461 GTACCCCACCCCAGGCTCCCAGG - Exonic
940431835 2:153600813-153600835 GTAATTCAGATGAGGATCCCTGG + Intergenic
946078736 2:217098065-217098087 GTTCCTCAGACTAGTATCCCAGG + Intergenic
946740580 2:222797095-222797117 GTACAGCAGAGGAGGCACCCTGG - Intergenic
1172347512 20:34215391-34215413 ATACATCAGAGGAGGCTCACAGG - Intronic
1174097050 20:48097794-48097816 GTCCCTCAGTCGTGGCTGCCTGG - Intergenic
1179084661 21:38206499-38206521 GGGCCTCAGAGGAGGATCCCTGG - Intronic
1181023493 22:20115239-20115261 GGACCTGTGACGGGGCTCCCGGG - Intronic
1181602146 22:23959047-23959069 GCAGCTCAGAATAGGCTCCCTGG + Intronic
1181606364 22:23982260-23982282 GCAGCTCAGAATAGGCTCCCTGG - Intronic
1181634734 22:24169319-24169341 GGACCTGGGACGAGGCTACCGGG - Intronic
1183322231 22:37172153-37172175 GCACCTCAGTTGAGGCTCTCTGG + Intronic
1184449095 22:44572341-44572363 GGACCTCAGAGCAGGGTCCCTGG + Intergenic
1185208364 22:49553093-49553115 GTACCTCAGACGAGGCTCCCAGG - Intronic
952130363 3:30354810-30354832 GGAGCTCAGCCCAGGCTCCCAGG + Intergenic
953881818 3:46694730-46694752 GTCACTCAGACAAGGGTCCCAGG - Intergenic
965881643 3:173395619-173395641 GAACCTCACACGTGACTCCCTGG + Intergenic
968634866 4:1672706-1672728 GCACCTCACAGGAGGCTCTCGGG - Intronic
969123113 4:4924242-4924264 GTACCCCTGAAGAGGCTCCTGGG - Intergenic
969605291 4:8199374-8199396 GTTCCTCAGAGGCAGCTCCCAGG - Exonic
982291072 4:153783278-153783300 GTACTACAGACAAGGCTCCCAGG - Intronic
986204900 5:5614218-5614240 TTACCTCAGAACTGGCTCCCTGG + Intergenic
997283240 5:132661562-132661584 TTACCTCAGATGAGGCTCTGAGG - Intergenic
1001308748 5:170595311-170595333 GCCCCTCAGACGCAGCTCCCTGG - Intronic
1019437257 7:1028529-1028551 GCTCCTCCGACGAGGCTCTCTGG + Intronic
1019892456 7:3956953-3956975 GTACCTCAGGGAAGGCACCCTGG + Intronic
1021403160 7:20233556-20233578 GTATCTCAGACCAGGCCCTCTGG + Intergenic
1023000217 7:35801011-35801033 CCCCCTCAGACGAGGCTTCCGGG - Exonic
1025234278 7:57223324-57223346 GTACAGCAGACCAGGCACCCGGG - Intergenic
1030060237 7:105615814-105615836 GTACCTCAGAGCAAACTCCCTGG + Intronic
1034188974 7:149199133-149199155 GCACCTCAAACCAGGCTGCCTGG + Intronic
1039314415 8:36355921-36355943 TTACCTAAGACGTGGCTCACCGG - Intergenic
1042418513 8:68556670-68556692 GTACATCGGCCGAGGATCCCTGG - Intronic
1042961680 8:74310079-74310101 GTACCTAAGCCCAGGCTCCATGG - Intronic
1049577511 8:143396603-143396625 GCACCTCGGAAGAGCCTCCCGGG + Intergenic
1053916517 9:42948509-42948531 GTGTCTCAGGCCAGGCTCCCTGG - Intergenic
1055715772 9:79116250-79116272 GTACCTCAGAGCAGGGTCTCTGG + Intergenic
1060196353 9:121626052-121626074 GCTCCTCAGAGGGGGCTCCCAGG - Intronic
1190127570 X:47720391-47720413 GCACCTCACACGAGGCTCCGTGG + Intergenic
1190265100 X:48823419-48823441 CTACGTCAGAGGAGGCTCCAGGG + Exonic
1197111451 X:122779826-122779848 ATACCTCAGAAGAGGCTCAGAGG + Intergenic